ID: 1002930302

View in Genome Browser
Species Human (GRCh38)
Location 6:1629719-1629741
Sequence CCCATTAGGCACCATGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002930302_1002930311 28 Left 1002930302 6:1629719-1629741 CCTCCTGCATGGTGCCTAATGGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1002930311 6:1629770-1629792 CGCCGATCCCACTTTTCTGATGG No data
1002930302_1002930312 29 Left 1002930302 6:1629719-1629741 CCTCCTGCATGGTGCCTAATGGG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1002930312 6:1629771-1629793 GCCGATCCCACTTTTCTGATGGG 0: 1
1: 0
2: 1
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002930302 Original CRISPR CCCATTAGGCACCATGCAGG AGG (reversed) Intronic
900321302 1:2085612-2085634 CCCGTGAGGCACCGTGCTGGAGG + Intronic
900321318 1:2085668-2085690 CCCGTGAGGCACCGTGCTGGAGG + Intronic
900321334 1:2085724-2085746 CCCGTGAGGCACCGTGCTGGAGG + Intronic
900321350 1:2085780-2085802 CCCGTGAGGCACCGTGCTGGAGG + Intronic
900585803 1:3431717-3431739 CGCATCAGGCAGCAGGCAGGGGG - Intronic
904773734 1:32894574-32894596 TCCATTTGGCTGCATGCAGGGGG - Exonic
905961530 1:42046393-42046415 CCCATCACCCCCCATGCAGGAGG - Intergenic
909496548 1:76285435-76285457 CCCATTAGGCACCATAGGTGCGG + Intronic
911588146 1:99714763-99714785 CCCAGTAGCTACCATGGAGGTGG + Intronic
915618403 1:157060672-157060694 GGCATTAGCCACCTTGCAGGAGG - Intergenic
1067407590 10:46037060-46037082 TCCATTAGGCACCTAGCATGAGG + Intronic
1067794978 10:49314379-49314401 CCCTTCAGGCAGCATGAAGGAGG - Intronic
1067809642 10:49417291-49417313 CCCAGCAGCCAGCATGCAGGTGG - Intergenic
1070150150 10:73800447-73800469 CACGGTAGGCAGCATGCAGGTGG - Exonic
1072155944 10:92723691-92723713 CCCATAAGGCACTTAGCAGGGGG + Intergenic
1074121267 10:110496120-110496142 TCCAGTACGCACCATGCTGGGGG + Intergenic
1074299041 10:112216542-112216564 CCCAGTAGGAGCCCTGCAGGGGG - Intergenic
1074815938 10:117140651-117140673 CCCTTTAGGAGCCCTGCAGGCGG + Intergenic
1083107711 11:60374305-60374327 CCCATCACGCACCCTGCAAGGGG + Intronic
1083161103 11:60854619-60854641 TCCATGAGGCTCCATGCAGGAGG + Intronic
1084444408 11:69195441-69195463 CCCAGTAGGCTCCTTGGAGGAGG + Intergenic
1090259836 11:125311405-125311427 CGCCTTAGACACCATGGAGGAGG + Intronic
1092811897 12:12278859-12278881 ATCATTAGGGACCATGCTGGAGG - Intergenic
1094249226 12:28340607-28340629 CCCATTACACACCCTGCAAGGGG - Intronic
1096621022 12:52865625-52865647 CACATCAGGCACCAGGGAGGTGG - Intergenic
1102397515 12:112599849-112599871 CCTATTAACCACTATGCAGGGGG - Intronic
1102557239 12:113735281-113735303 CCCATGAGGCCGAATGCAGGAGG + Intergenic
1104896001 12:132163879-132163901 CCCATGAGGCACCTTCCTGGAGG - Intergenic
1110162994 13:72401839-72401861 CCCATGAGCCCCCATGCAGCTGG - Intergenic
1114423790 14:22605686-22605708 GCCATGAGGGACTATGCAGGAGG + Intronic
1118640188 14:67785134-67785156 CCCATCAGGCAGCAGGCAGATGG - Exonic
1118671429 14:68132218-68132240 CCCATTAGGCTGCATTCAGTGGG + Intronic
1119891177 14:78183339-78183361 TCCAGTAGGCACCACGCAGAGGG - Intergenic
1122628993 14:103098939-103098961 CCCAGCAGGCACCTTGCTGGAGG + Intergenic
1123767801 15:23499180-23499202 CCCATTAGGCCCCAGGAAGCTGG - Intergenic
1130445882 15:84001584-84001606 CAGAATAGGCACCACGCAGGAGG + Intronic
1131841989 15:96447289-96447311 CCATTTAGGCACCAAGAAGGAGG - Intergenic
1132759473 16:1501790-1501812 CCCAGTGGGCAGCGTGCAGGAGG + Intronic
1136028305 16:27484323-27484345 CCCATTTGTCACCTGGCAGGTGG - Exonic
1139474187 16:67194423-67194445 CCCATCAGGCACCAGCCTGGAGG + Exonic
1144661181 17:17071990-17072012 CCCAAAAGGCAGCAGGCAGGAGG - Intronic
1144826596 17:18108781-18108803 CCCATGAGGCGGCATGCAGGCGG + Exonic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1150922529 17:69498488-69498510 CCCAAAAGGACCCATGCAGGTGG - Intronic
1151088886 17:71412545-71412567 CCCATTTGGCACCAAACAGATGG + Intergenic
1152666350 17:81571959-81571981 CCCATTGGGCGCCTTGTAGGTGG - Intronic
1153824461 18:8862817-8862839 CTCATTAGGCTTCATGGAGGAGG - Intergenic
1156374681 18:36502788-36502810 ACCATTAGGAAACATGCATGTGG - Intronic
1157428198 18:47601988-47602010 CCCATTATGCACACTGCATGGGG + Intergenic
1160027367 18:75229404-75229426 CACTGTATGCACCATGCAGGGGG + Intronic
1161407571 19:4099070-4099092 CACAGTCGGCACCATCCAGGGGG + Intronic
1162974808 19:14202640-14202662 CCCACCCAGCACCATGCAGGGGG - Intronic
1164039583 19:21483316-21483338 CCCACCAGGCATGATGCAGGGGG + Intronic
928348154 2:30519649-30519671 CCCATTAGGCTAAAAGCAGGAGG + Intronic
928440066 2:31284861-31284883 CCCATTAGGCTAAAAGCAGGAGG + Intergenic
932413034 2:71558463-71558485 ACCATGAGTCACCTTGCAGGTGG - Intronic
936065929 2:109332185-109332207 CCCATGAGGCAGCTTGCAGAGGG - Intronic
937539649 2:122933495-122933517 CCCATAAGGCAACATGAAGAGGG - Intergenic
939026554 2:137020650-137020672 CCCATTAGCCTCCAGGCAGCTGG + Intronic
939508372 2:143076244-143076266 CCCATTAGGGACTCTGCATGGGG - Intergenic
1172049889 20:32109469-32109491 CCCATTACCCACAATGCAGCGGG + Intergenic
1174559665 20:51421637-51421659 CCCAGTAGCTGCCATGCAGGAGG + Intronic
1179613772 21:42568893-42568915 CCCCTTAGGGAGCAGGCAGGTGG + Intronic
1181492781 22:23271021-23271043 GCAATTAGACAGCATGCAGGGGG - Intronic
1182533286 22:30979699-30979721 CACATTAGGCAGAAAGCAGGGGG + Intergenic
1183468364 22:37991847-37991869 CCCAGCAGGGACAATGCAGGAGG - Intronic
1184314221 22:43671123-43671145 GCCATTAGGAACCATGCAGATGG - Intronic
1184458962 22:44626366-44626388 CCCATCAGGCCGCCTGCAGGCGG - Intergenic
1184477274 22:44728624-44728646 CCCTTTTGGCCCCATGCAGTGGG + Intronic
950368093 3:12503517-12503539 GCCATTAGGCTGCCTGCAGGAGG + Exonic
952764379 3:36942553-36942575 CCCACTGGGATCCATGCAGGAGG + Intronic
952816973 3:37454056-37454078 CACACTAGGCACCAGGCACGCGG + Intronic
954696978 3:52432757-52432779 CCTATTGGGCACACTGCAGGAGG - Intergenic
955047910 3:55377194-55377216 CCCATGAGGCACCAGCCAAGTGG - Intergenic
959400713 3:105898701-105898723 CCCATTAGGTACTATGCATTGGG - Intergenic
960058826 3:113297928-113297950 GCCATTATGCACAATCCAGGAGG + Intronic
961041408 3:123681211-123681233 TCCATTAGGCACCATGCGTAGGG - Intronic
961666401 3:128495811-128495833 CCCAGTAGGCAGGAGGCAGGTGG - Intergenic
965019291 3:163206810-163206832 CCCATTAGGCAACAAGCACAAGG + Intergenic
965046483 3:163584740-163584762 CCCAGTAGGCACTCTGCATGAGG + Intergenic
966855492 3:184191113-184191135 CCCATCAGGGAACCTGCAGGAGG - Exonic
968470142 4:776906-776928 CACATTGGGCACCATGGGGGTGG - Intergenic
969198097 4:5579143-5579165 CCCCTTGGCCACCGTGCAGGGGG + Intronic
969483715 4:7460102-7460124 AGCACTGGGCACCATGCAGGGGG - Intronic
974822945 4:67091238-67091260 CCCTTTAGGCACAGTACAGGAGG - Intergenic
975395711 4:73870631-73870653 CACATTAGGCACAATCCAGGTGG - Exonic
975415155 4:74097639-74097661 CACATTAGGCGCAATCCAGGTGG + Exonic
977869334 4:102071283-102071305 ACCATTGTGCACCATCCAGGTGG + Exonic
984101702 4:175495173-175495195 GCCATTAGGCTGCCTGCAGGAGG + Intergenic
987692700 5:21287897-21287919 CACATTGGGCACACTGCAGGTGG + Intergenic
991747655 5:69762150-69762172 CACATTGGGCACACTGCAGGTGG - Intergenic
991750074 5:69793174-69793196 CACATTGGGCACACTGCAGGTGG + Intergenic
991799233 5:70342004-70342026 CACATTGGGCACACTGCAGGTGG - Intergenic
991801647 5:70372979-70373001 CACATTGGGCACACTGCAGGTGG + Intergenic
991826949 5:70637047-70637069 CACATTGGGCACACTGCAGGTGG - Intergenic
991829364 5:70668032-70668054 CACATTGGGCACACTGCAGGTGG + Intergenic
991891592 5:71341431-71341453 CACATTGGGCACACTGCAGGTGG - Intergenic
998959317 5:147467885-147467907 CCTAGAAGGCACCATCCAGGAGG - Intronic
1002930302 6:1629719-1629741 CCCATTAGGCACCATGCAGGAGG - Intronic
1014478970 6:121911715-121911737 CCCAATAGCCAGTATGCAGGTGG - Intergenic
1016045153 6:139473443-139473465 CCCATTTGGCACCAGAGAGGGGG + Intergenic
1020070493 7:5223855-5223877 CCCTGGAGGCACCATTCAGGCGG - Intronic
1022677365 7:32512441-32512463 ACCAGTAGGCACAAAGCAGGTGG + Intronic
1023028432 7:36072753-36072775 CCGAGTAAGCACCATGAAGGAGG + Intergenic
1026311668 7:69191174-69191196 CTCATTAGTCACCGTGCAGAGGG - Intergenic
1026535412 7:71234878-71234900 CCCAACAGTCACTATGCAGGAGG - Intronic
1029563193 7:101317680-101317702 CCCACCAGGCACCATGAAGTTGG - Intronic
1030452530 7:109730988-109731010 CCCATTAGGGACCCTGCGTGGGG + Intergenic
1037366910 8:18132375-18132397 TCCATTAGGCAGCATGTAGTTGG - Intergenic
1045359098 8:101415353-101415375 CCCAGCAGGCCCCATGCAGGTGG - Intergenic
1048862709 8:138736027-138736049 CCTCTTTGGCACCAAGCAGGTGG - Intronic
1048955093 8:139529324-139529346 CCCATTCAGGTCCATGCAGGGGG - Intergenic
1050268673 9:3918495-3918517 CCCATAAGGTACCATGAAGACGG - Intronic
1054931691 9:70641844-70641866 AACATTAGGCTCCAGGCAGGGGG + Intronic
1057263557 9:93599424-93599446 CCCATTGGGATCCAGGCAGGGGG + Intronic
1193517223 X:82481055-82481077 CCCATGAGACACCATGCAGAGGG + Intergenic
1196188399 X:112769500-112769522 CCCATTTGACAACATGCAGTTGG + Intergenic
1200125141 X:153809921-153809943 CCCATTACGCACAGCGCAGGTGG + Intronic
1200900028 Y:8421165-8421187 CTCATTAAGCATCATTCAGGTGG - Intergenic