ID: 1002932399

View in Genome Browser
Species Human (GRCh38)
Location 6:1643634-1643656
Sequence GACCACCTGGGCCACGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002932399 Original CRISPR GACCACCTGGGCCACGGTGG GGG Intronic
900981875 1:6050328-6050350 GGCCACCTGGGCCATGGCCGAGG + Intronic
901165830 1:7220937-7220959 GACCTCCTGGGCCCAGCTGGAGG - Intronic
902368124 1:15990450-15990472 GGCCTCCTGGGCCAGGGTGCTGG - Intergenic
902520558 1:17013290-17013312 GACCACCTGGGCCATGGGACTGG + Intergenic
902622690 1:17659608-17659630 CACCACCAGGGCCACTATGGTGG - Intronic
902717449 1:18282326-18282348 AATCACCTGGGCCAGAGTGGGGG - Intronic
903028887 1:20448777-20448799 GCCCTCCTGGGCCGGGGTGGAGG - Intergenic
903544807 1:24117283-24117305 GATCACCTGAGCCAGGGAGGTGG + Intergenic
903846434 1:26282199-26282221 GACCAGCTGGGCCAGGGAGGGGG - Intronic
904575981 1:31505348-31505370 GATCAGCTGGGCCTGGGTGGGGG + Intergenic
905403681 1:37719602-37719624 GATCACCTGGGCCACAGGGGTGG + Exonic
905945373 1:41897276-41897298 CATCACCTGGGGCACGGTAGAGG + Intronic
906075920 1:43051978-43052000 CACCACCAGGGCCACTATGGAGG + Intergenic
906640824 1:47439381-47439403 CACATCATGGGCCACGGTGGCGG + Exonic
906793619 1:48679439-48679461 TACAACCAGGGCCACAGTGGGGG + Intronic
908122335 1:60997985-60998007 GATCACTTGAGCCCCGGTGGTGG + Intronic
912787457 1:112618874-112618896 GACCTCCTGGGGCAGGGCGGGGG - Intronic
913184440 1:116356170-116356192 GATCACCTGGGCCTGGGAGGTGG + Intergenic
914805939 1:150991738-150991760 CACCACGTTGGCCACGCTGGTGG + Intronic
914806395 1:150995202-150995224 GAGCACTTGGGCCATAGTGGTGG + Intronic
916745779 1:167683943-167683965 GGCCAGCTGGGCCACCGAGGGGG - Exonic
916828094 1:168462870-168462892 GACCACCTTGGCCAACATGGTGG + Intergenic
918246723 1:182667075-182667097 GACCACCTGGGGAAGGGTGGGGG - Intronic
920019299 1:202942121-202942143 GCCCATCTGGCCCACTGTGGTGG + Exonic
922111774 1:222565773-222565795 GATCACCTGAGCCAGGGAGGTGG + Intronic
923619319 1:235565133-235565155 GACCACTCGGGCCATGGTGCTGG + Intronic
924707916 1:246513260-246513282 GGCCTCCTGGGCCAGGGTGCCGG + Intergenic
1062860260 10:805070-805092 GGCCACCTGGGAGACGGGGGAGG - Intergenic
1062869651 10:888996-889018 GACCACCTGAGCCCAGGAGGTGG + Intronic
1063036441 10:2290755-2290777 GCCCACCTGGGCCACACAGGAGG - Intergenic
1063039946 10:2327478-2327500 CACGTCCTGGGCCACGGTCGTGG + Intergenic
1063128324 10:3154888-3154910 GACGACCTAGGCCAGGATGGTGG - Intronic
1063638391 10:7807151-7807173 GAGCACCTGGGCAACGCTAGTGG + Intronic
1065085009 10:22165238-22165260 GCCCATCTGGCCCACTGTGGTGG - Intergenic
1065726321 10:28670863-28670885 GATCACTTGAGCCATGGTGGTGG + Intergenic
1069512287 10:69051451-69051473 GACCACGGGGGCCACGATGAGGG - Intergenic
1072850990 10:98891854-98891876 GATCACCTGAGCCAGGGAGGTGG - Intronic
1074995491 10:118754451-118754473 GGCCGCCTTGGCCACGGCGGCGG + Exonic
1075572357 10:123555625-123555647 GTCCACCTGGCCCACGGTTGGGG - Intergenic
1076498485 10:130915291-130915313 GAGCACCTGGGTCAAGGTGCAGG + Intergenic
1076915442 10:133421118-133421140 GAGCACCAGGGCCCTGGTGGAGG - Exonic
1077119289 11:899470-899492 GACCATGTGGGCCGAGGTGGCGG - Intronic
1077664701 11:4097085-4097107 GACCAGCTGGGCCAACATGGTGG + Intronic
1078479529 11:11663924-11663946 GCCCACCTGGGCCAGGTAGGAGG + Intergenic
1078634847 11:13039719-13039741 GATCACCTGGGCAAGGGTGGTGG + Intergenic
1078999629 11:16740487-16740509 GATCACCTGAGCCAGGGAGGTGG - Intronic
1081330508 11:41794272-41794294 GCACACCTGGGCCAGGGGGGAGG - Intergenic
1081911224 11:46701125-46701147 ATCCACCTGGGCCAAGGTTGAGG - Intronic
1084045383 11:66565001-66565023 GCCCTCCTGGGGAACGGTGGGGG + Exonic
1084092291 11:66886557-66886579 GAGGACCTGAACCACGGTGGTGG + Intronic
1084476484 11:69392298-69392320 GACCTCCTGGACCACAGGGGAGG + Intergenic
1085025211 11:73232496-73232518 GATCACCTGGGCCCAGGAGGTGG - Intronic
1085401748 11:76239752-76239774 GCCAGCCTGGGCCAGGGTGGTGG - Intergenic
1086123531 11:83326437-83326459 TGCCACCTGGGCCAAGGTGCAGG - Intergenic
1088216173 11:107512398-107512420 GATCACCTGGGCCTGGGAGGTGG - Intronic
1092172830 12:6384277-6384299 GACGTCCTGGGCAGCGGTGGCGG - Exonic
1092238120 12:6822222-6822244 CACCAGCTGGGCCTGGGTGGAGG + Intronic
1093695967 12:22160800-22160822 GTCCACCTGGGCCTCTGCGGTGG + Intronic
1094619288 12:32064788-32064810 GATCACCTGAGCCTGGGTGGTGG + Intergenic
1096559368 12:52424677-52424699 GGAAACCTGGGCCTCGGTGGGGG - Exonic
1104291690 12:127475275-127475297 GATCACCTGAGCCAAGGAGGGGG - Intergenic
1104825026 12:131701941-131701963 AGCCACGTGGGCCACGGGGGTGG - Intergenic
1105263064 13:18794057-18794079 CAGCAGCTGGGCCACGGTGCTGG + Intergenic
1108674884 13:52728098-52728120 AATCACCTGGGCCAGGGCGGTGG + Intronic
1111217885 13:85167958-85167980 GACCACCCTGGCCAAGATGGTGG - Intergenic
1111708312 13:91779445-91779467 GATCACCTGAGCCAGGGTGGCGG - Intronic
1113572306 13:111367004-111367026 GACCGGCTGGGCCACCATGGTGG - Intergenic
1113682032 13:112251225-112251247 GCCCACCAAGGCCACGCTGGGGG + Intergenic
1113775979 13:112944893-112944915 GAACACTGGGCCCACGGTGGTGG - Intronic
1114069995 14:19098624-19098646 GGGCACCTGGGCCCCGGTCGAGG - Intergenic
1114092267 14:19301378-19301400 GGGCACCTGGGCCCCGGTCGAGG + Intergenic
1114263382 14:21055840-21055862 GACTTCCTGGGACAGGGTGGTGG + Intronic
1119228792 14:72963994-72964016 GCCTTCCTGGGCCATGGTGGTGG + Intergenic
1121528241 14:94634281-94634303 GCCCATCTGGCCCACTGTGGTGG - Intergenic
1122400879 14:101466642-101466664 GACCACCTTGGCCTGGCTGGGGG - Intergenic
1122548789 14:102539107-102539129 GCCCACCAGGGCCAGGGTGGGGG - Intergenic
1124343127 15:28902768-28902790 CACCACCAGGGACATGGTGGAGG - Intronic
1125631666 15:41152051-41152073 CTCCACCTGCGCCCCGGTGGGGG + Intergenic
1129482201 15:75835902-75835924 GATCACCTGGGCCACTGAGAAGG - Intergenic
1129878539 15:78992630-78992652 GACCACCTGGGCCACACAGGAGG + Intronic
1129892789 15:79082615-79082637 GCCAACCTGGACCACAGTGGTGG + Intronic
1130036165 15:80363363-80363385 GAGCAGCAGGGCCATGGTGGGGG - Intronic
1131538045 15:93253802-93253824 CACCACCTGGGCCCAGCTGGAGG + Intergenic
1132404714 15:101535419-101535441 GACCACAGGGCCCAGGGTGGTGG + Intergenic
1132804825 16:1770588-1770610 GCCCACCTGGGCCCTGGAGGAGG + Exonic
1134117135 16:11557534-11557556 GATCACCTGAGCCTGGGTGGTGG - Intronic
1134421792 16:14099460-14099482 GACCACTTGAGCCAAGGAGGCGG - Intronic
1136233598 16:28902059-28902081 GACCACCTCGCCCACGTTGGAGG - Exonic
1136428411 16:30183940-30183962 GACCACCGCGGCCAAGATGGAGG + Intronic
1138415262 16:56867972-56867994 GACCACTGGGGCCATGGTCGGGG + Intronic
1140674820 16:77317529-77317551 GACCAGCTGGGCCAACGTGGCGG - Intronic
1141502126 16:84451520-84451542 GAGGATCTGGGCCATGGTGGGGG + Intronic
1142231167 16:88900958-88900980 GAGCACGGGGGCCAGGGTGGGGG - Intronic
1144587228 17:16494391-16494413 GATCACCTGGGGGAGGGTGGGGG + Intergenic
1145101934 17:20084858-20084880 GACCATCTGGGCAAGGGAGGTGG + Intronic
1145760929 17:27425252-27425274 GGCCTCCTGGGCCAGGGTGCCGG - Intergenic
1146160969 17:30559409-30559431 GGCCTCCTGGGCCAGGGTGCCGG - Exonic
1146370978 17:32265704-32265726 GACCGACTGGGCCCGGGTGGCGG + Intergenic
1147449725 17:40496411-40496433 CATCACCTGGGACATGGTGGGGG + Exonic
1152383765 17:79956539-79956561 GACCACCGGGCCCAGCGTGGTGG - Intronic
1152408903 17:80112202-80112224 GACCACCCGGGGCCCGCTGGCGG + Intergenic
1153748016 18:8200273-8200295 GTCCACCTGGGTCTCGGTGGGGG - Intronic
1155270316 18:24135198-24135220 GACCAGCCTGGCCAAGGTGGTGG - Intronic
1160831395 19:1106307-1106329 GCCCATCTGGGCCACGGCTGTGG - Intronic
1161687814 19:5712066-5712088 GACCACCTGTGCCACCAGGGAGG - Intronic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1163777351 19:19226270-19226292 GACCACCTGAGCCACTGTCAGGG - Intronic
1163828924 19:19538561-19538583 GACCACCTGGGGCGCGGAGCGGG + Intronic
1164742378 19:30585485-30585507 GACCACCAGGGCCACAGTCATGG - Intronic
1164789049 19:30960429-30960451 GATCACTTGAGCCACGGTTGAGG + Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165803396 19:38566249-38566271 GACCATCCTGGCCACCGTGGTGG + Intronic
1166220263 19:41359844-41359866 GGCCACGTGGGCCATGGTGGAGG - Intronic
1167456251 19:49597832-49597854 GGCCACCCCGGCCACGGGGGAGG + Exonic
1167620635 19:50558315-50558337 GATCACCTGGGCCTGGGAGGTGG - Intronic
1167886503 19:52504286-52504308 GACCACCCTGGCCAATGTGGTGG - Intronic
1168119473 19:54243540-54243562 GACCACCTGGGCCCGGGAGGCGG + Intronic
1168291017 19:55357583-55357605 GAGCACCTGGGCTGTGGTGGGGG + Intronic
1168641745 19:58035308-58035330 GAACACCTAGGCCAATGTGGGGG - Intronic
925395427 2:3529965-3529987 GACCACCCAGTCCAGGGTGGGGG - Intergenic
926339757 2:11895242-11895264 GACCACATGGACCACGGGGATGG - Intergenic
927983397 2:27389880-27389902 GACCACCTGAGCCCAGGAGGTGG + Intronic
928013569 2:27633390-27633412 GATCACCTGAGCCAGGGAGGTGG - Intronic
928123340 2:28599496-28599518 GATCTCCTAGGACACGGTGGTGG - Intronic
928444542 2:31321229-31321251 GACCAGGTGGACCACGGTGGTGG - Intergenic
928517994 2:32062129-32062151 GATCACCTGAGCCAGGGAGGTGG + Intergenic
928921072 2:36528654-36528676 GACAACCTGGGCCTCCGTGTAGG - Intronic
930158945 2:48133199-48133221 GATCACCTGAGCCAGGGAGGTGG + Intergenic
930719762 2:54627788-54627810 GGCCAGCGGGGCCAGGGTGGGGG - Intronic
935129816 2:100253306-100253328 GAGTCCCTGGGCCAGGGTGGAGG + Intergenic
935903456 2:107817502-107817524 GCCCAGCTGAGCCACGGTTGGGG + Intergenic
938043135 2:128092775-128092797 GACCACCTGAGCCCAGGAGGTGG - Intronic
938577843 2:132620544-132620566 GAGCACCTGAGCCACGCAGGGGG - Intronic
942099048 2:172559931-172559953 GATCACCTGAGCCAGGGAGGTGG - Intronic
946415504 2:219538001-219538023 GACCTCCTGGGGGACCGTGGGGG - Exonic
946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG + Intronic
947049906 2:226030820-226030842 GTGCTCCTGGGCCACGCTGGCGG - Intergenic
947600806 2:231448815-231448837 GATCACCTGAGCCACTGGGGAGG - Intergenic
948452151 2:238082431-238082453 GCCCACATGGGGCAGGGTGGGGG + Intronic
948478434 2:238236065-238236087 GAACGCCTGGGCCAGGGTGCAGG + Intergenic
1170900936 20:20462474-20462496 GACCATTGGGGCCAGGGTGGAGG - Intronic
1173489574 20:43468845-43468867 GATCACCTGGGCCCTGGAGGTGG + Intergenic
1176091449 20:63320215-63320237 CACCTGCTGGGCCACGCTGGTGG + Intronic
1176287019 21:5023659-5023681 GGCTTCCTGGGCCAGGGTGGGGG - Intronic
1178841554 21:36141695-36141717 GGCCACCTGGACCTCAGTGGAGG + Intronic
1179001715 21:37467314-37467336 GATCACCTGGGCCCAGGAGGAGG - Intronic
1179255925 21:39715202-39715224 GATCACCTGAGCCAGGGAGGTGG - Intergenic
1179455852 21:41499509-41499531 CATCACCTGTGGCACGGTGGAGG - Intronic
1179476363 21:41648732-41648754 GACCAGCTGGGCCCCGGGGGAGG + Intergenic
1179870162 21:44239816-44239838 GGCTTCCTGGGCCAGGGTGGGGG + Intronic
1180488463 22:15821188-15821210 GGGCACCTGGGCCCCGGTCGAGG - Intergenic
1182018759 22:27063307-27063329 GGCCACCTAGGGCAGGGTGGGGG - Intergenic
1182548716 22:31089991-31090013 GACCACCTGGCCCTCAGTGCTGG - Exonic
1183298181 22:37044309-37044331 GACCACCTGGGCCCCGGGCTCGG - Intergenic
1184030359 22:41890707-41890729 CACCATCTTGGCCACGCTGGTGG - Intronic
1185044676 22:48523042-48523064 GAGCCCATGGGTCACGGTGGAGG + Intronic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
1185116275 22:48940055-48940077 GACCTCCAGGGCCAGGGCGGGGG - Intergenic
950265473 3:11569792-11569814 GATCACCTGGGCCCAGGAGGTGG + Intronic
954880240 3:53830923-53830945 CACCAGCTTGGCCACAGTGGAGG + Intronic
960022737 3:112973874-112973896 GAGAACTTGGGCCACTGTGGGGG - Intronic
960365265 3:116763193-116763215 GATCACCTGAGCCCAGGTGGCGG + Intronic
961457164 3:127029984-127030006 GACCACCTGGACCAGCGTGAGGG + Exonic
962138060 3:132758405-132758427 GATCACATGGGCCAGGGAGGTGG + Intergenic
963020462 3:140868651-140868673 TACCAACTCGGCCACAGTGGGGG - Intergenic
963469429 3:145721477-145721499 CATCACCTGGGCTATGGTGGAGG - Intergenic
964796572 3:160503995-160504017 GATCACCTGAGCCAGGGAGGGGG + Intronic
965681867 3:171260101-171260123 CATCACCTGGGGCATGGTGGAGG - Intronic
969531754 4:7734277-7734299 GAGCAGCTGGGCGGCGGTGGCGG + Exonic
978382069 4:108139560-108139582 GGCCAGCAGGGCCAGGGTGGAGG - Intronic
980789478 4:137601410-137601432 GACCAGCTTGGCCAACGTGGTGG + Intergenic
985432296 4:189893062-189893084 GCCCAGCTGGGGGACGGTGGGGG + Intergenic
985973199 5:3393436-3393458 GACCCCCGAGGACACGGTGGGGG - Intergenic
987457907 5:18169789-18169811 TACCAGCTTGGCCACAGTGGGGG + Intergenic
991083872 5:62630580-62630602 GAACACCTGAGCCAGGGAGGTGG - Intergenic
992747652 5:79835258-79835280 GGCCACCTGGACCAGGCTGGTGG - Intergenic
992800135 5:80288517-80288539 GACCAGCTGGGCCACGTAGCTGG - Intergenic
996379118 5:122845771-122845793 GACCCCCTGCGCCAAGGCGGCGG - Intronic
996535143 5:124570046-124570068 GGACGCCTGGACCACGGTGGAGG + Intergenic
998511764 5:142719779-142719801 GACCACCTGGGCTTCGGTCTTGG - Intergenic
999150599 5:149423814-149423836 GACAACCTGGGCAACTGGGGAGG - Intergenic
1002498094 5:179629377-179629399 GATCACCTGAGCCTGGGTGGGGG - Intronic
1002932399 6:1643634-1643656 GACCACCTGGGCCACGGTGGGGG + Intronic
1003192566 6:3887471-3887493 GGGAACCTGGGCCACGGTGAGGG - Intergenic
1006319312 6:33310730-33310752 GATCACTTGAGCCACGGAGGTGG + Intronic
1006950954 6:37820269-37820291 GGCCTCCTGGGCCACGGGTGAGG + Intronic
1007553079 6:42745227-42745249 GACCAGCAGGGCCATCGTGGAGG - Exonic
1010318419 6:74477738-74477760 GACCACCTCTACCAGGGTGGTGG - Intergenic
1012497027 6:99844743-99844765 GATTACCTGGGCAATGGTGGAGG - Intergenic
1013460122 6:110366692-110366714 AACCACCTGAGCCACTGGGGTGG - Intergenic
1014401526 6:120996278-120996300 GATCACCTGGGCCTGGGAGGCGG + Intergenic
1014874287 6:126637785-126637807 GACCACCTGGGCAACATAGGTGG - Intergenic
1015105560 6:129532443-129532465 GACCAGCCTGGCCAAGGTGGTGG - Intergenic
1016373013 6:143393835-143393857 GACCACTTGGGCCCAGGAGGTGG - Intergenic
1016713976 6:147203652-147203674 GGCCTGCTGGGCCAGGGTGGGGG + Intergenic
1016881950 6:148920385-148920407 GACCACATTGGCCAGTGTGGAGG - Intronic
1017013237 6:150079193-150079215 GATCACCTGGGCCTGGGAGGTGG + Intergenic
1017505811 6:155067725-155067747 GACCACCTGAGCCAGGGAGGTGG - Intronic
1018016756 6:159719537-159719559 GATCACCTGGGCAAAGGAGGTGG + Intronic
1019411527 7:908856-908878 GGCCACCTCGCCCACGGGGGTGG + Intronic
1019637638 7:2084590-2084612 TACTTCCTGAGCCACGGTGGCGG + Intronic
1026863041 7:73806023-73806045 TATCACCTGGGGCATGGTGGAGG - Intronic
1029543417 7:101198051-101198073 GCCCACGTGGGCCTCGGTGCAGG + Intronic
1031158977 7:118143447-118143469 GCCCACCTGGGCAGAGGTGGTGG - Intergenic
1031959226 7:127973889-127973911 GACCACCTGAACCTCTGTGGGGG + Intronic
1032441595 7:131946411-131946433 CACAACCTGGCCCCCGGTGGAGG - Intergenic
1033227500 7:139573161-139573183 CACCAGGTGGGCCACGGTGCCGG + Exonic
1033641700 7:143268104-143268126 ATCCACATGGGCCACGGTGATGG - Exonic
1034348957 7:150404369-150404391 CACAAGCTGGGCCACGGTGCTGG + Intronic
1034966479 7:155394602-155394624 GAGCACCTGCTCCATGGTGGTGG + Intronic
1035751802 8:2001794-2001816 CACCACCTCGGCCACGTTGTCGG - Exonic
1036025266 8:4900477-4900499 GACAGCCTGGGCCAGGGTGAAGG - Intronic
1037473783 8:19237205-19237227 ATCCACCAGGGCCACGGTAGTGG - Intergenic
1039984962 8:42439369-42439391 GACCAGCTGGGCCTGGGTGTGGG - Intronic
1044679915 8:94766981-94767003 GACCACCTGAGCCTGGGAGGTGG + Intronic
1044871892 8:96627938-96627960 GATCACCTGGGCCTGGGAGGTGG - Intergenic
1047383494 8:124386209-124386231 GACCACTTGGGGCAGGGAGGTGG + Intergenic
1049033682 8:140057954-140057976 GACCACCTGCACCACGCTGGGGG + Intronic
1049601384 8:143509415-143509437 CCCCACCTGGGCCAAGCTGGGGG + Intronic
1049611671 8:143558783-143558805 GGGCACCTGGGCCACTGTGGAGG - Intronic
1049803494 8:144528753-144528775 GACCACCAGGGCCAGGTGGGCGG - Exonic
1051294690 9:15583215-15583237 GACCATCCTGGCCAAGGTGGTGG + Intronic
1052034009 9:23659801-23659823 TACCACCTGGGCCCTGTTGGAGG - Intergenic
1052861862 9:33442414-33442436 GACCACCAGGCCCACGGTGAAGG + Exonic
1053829846 9:42066704-42066726 AATCACCTGGGCCAGCGTGGTGG - Intronic
1054172959 9:61857198-61857220 GAACACCTGGGACCCGGGGGTGG - Intergenic
1054600712 9:67120749-67120771 AATCACCTGGGCCAGCGTGGTGG + Intergenic
1054664583 9:67723583-67723605 GAACACCTGGGACCCGGGGGTGG + Intergenic
1056786271 9:89594749-89594771 GACCTGCTGGGCCATGGCGGGGG - Intergenic
1057244776 9:93445675-93445697 GACTACTTGAGCCAAGGTGGTGG - Intergenic
1058134047 9:101287696-101287718 GACCAGCTTGGCCAAGATGGTGG - Intronic
1060660073 9:125400039-125400061 GACCACCTGGAGCACGCTGGAGG - Intergenic
1061223953 9:129269666-129269688 GATCACCTGAGCCAGGGAGGTGG - Intergenic
1061637216 9:131919893-131919915 GATCACCTGAGCCCCGGAGGTGG - Intronic
1062537263 9:137026535-137026557 GGCCCACTGGGCCACAGTGGAGG - Intronic
1187400038 X:18951182-18951204 CGCCACCTGTGGCACGGTGGTGG - Exonic
1187492354 X:19763927-19763949 GACCACCTGAGCCCAGGAGGTGG + Intronic
1190076797 X:47322772-47322794 GCCCACTGGGGGCACGGTGGGGG + Intergenic
1192234651 X:69287988-69288010 GATCACCTGGGCCCAGGAGGTGG + Intergenic
1192380560 X:70612046-70612068 GATCACTTGGGCCTGGGTGGGGG + Intronic
1200039741 X:153356253-153356275 GACCTTCTGAGCCATGGTGGAGG - Intronic
1200169343 X:154060988-154061010 GGACACCTGGACCAGGGTGGGGG + Intronic