ID: 1002932618

View in Genome Browser
Species Human (GRCh38)
Location 6:1644793-1644815
Sequence CTCTGACAGCTTTGGCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 433}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002932610_1002932618 27 Left 1002932610 6:1644743-1644765 CCCACTGCCGTTTCTTGCACCTG 0: 1
1: 0
2: 0
3: 8
4: 158
Right 1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 433
1002932609_1002932618 28 Left 1002932609 6:1644742-1644764 CCCCACTGCCGTTTCTTGCACCT 0: 1
1: 0
2: 1
3: 13
4: 191
Right 1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 433
1002932613_1002932618 8 Left 1002932613 6:1644762-1644784 CCTGTACTGTGAGCCTTGCACCC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 433
1002932612_1002932618 20 Left 1002932612 6:1644750-1644772 CCGTTTCTTGCACCTGTACTGTG 0: 1
1: 0
2: 2
3: 23
4: 218
Right 1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 433
1002932611_1002932618 26 Left 1002932611 6:1644744-1644766 CCACTGCCGTTTCTTGCACCTGT 0: 1
1: 0
2: 0
3: 16
4: 185
Right 1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 433
1002932608_1002932618 29 Left 1002932608 6:1644741-1644763 CCCCCACTGCCGTTTCTTGCACC 0: 1
1: 1
2: 1
3: 17
4: 182
Right 1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 433
1002932614_1002932618 -5 Left 1002932614 6:1644775-1644797 CCTTGCACCCACTGCAAGCTCTG 0: 1
1: 0
2: 3
3: 28
4: 411
Right 1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG 0: 1
1: 0
2: 1
3: 25
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002932618 Original CRISPR CTCTGACAGCTTTGGCTCTC AGG Intronic
904489630 1:30850371-30850393 CTGTGACAGCTTTCTCTCTGGGG - Intergenic
904748495 1:32725874-32725896 CCCTGACAGCTTAAGCTGTCAGG + Intergenic
904748496 1:32725875-32725897 CCCTGACAGCTTAAGCTGTCAGG - Intergenic
906169564 1:43712971-43712993 CTTTGTCAGCTTTGCCTTTCAGG + Intronic
906883476 1:49618632-49618654 CTCTGCCAGCTTTTGGTATCAGG - Intronic
907002694 1:50877841-50877863 CTCTGAGAGCTTTTTCCCTCTGG - Intronic
907525734 1:55052925-55052947 CCCTGCCAGCCTTGGCACTCTGG - Intronic
907612990 1:55891437-55891459 CTCTGCCAGGTTTTGGTCTCAGG + Intergenic
908058980 1:60325829-60325851 CTCTGACAGGTTTGGGTATCAGG + Intergenic
908332909 1:63088257-63088279 CCCTAACAGCTTTGGCCTTCGGG - Intergenic
908547082 1:65172686-65172708 CTCTGCCAGATTTTGCTTTCTGG - Intronic
909363579 1:74793640-74793662 CTCTGTCAGCTGTGGCTGACAGG - Intergenic
909678145 1:78260767-78260789 CTCTGACAGGTTTTGGTGTCAGG - Intergenic
910016512 1:82531600-82531622 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
910247873 1:85161648-85161670 CACTGAAACCTTTGCCTCTCAGG - Intronic
911021850 1:93397110-93397132 CCCTGACAGCTTTGGCTTTGAGG - Intergenic
911537197 1:99114637-99114659 CTCTGACAGGTTTTGGTATCAGG + Intergenic
911876142 1:103165534-103165556 CTCTGACAGGTTTTGGTATCAGG + Intergenic
911898800 1:103474088-103474110 TTCTCACAGCTTTGGCTCTTTGG - Intergenic
911904211 1:103546515-103546537 CTCTCATAGCTTGGGTTCTCTGG + Intronic
911994035 1:104739801-104739823 CTCTGTCAGCCTTGGATCTGTGG - Intergenic
912284222 1:108351220-108351242 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
912365091 1:109126829-109126851 CTTGGACAGCTTTGGCTGTGAGG + Intronic
912427479 1:109607373-109607395 CACTGCCAGCTTTGCCTCCCGGG - Exonic
912676251 1:111683826-111683848 CTCTGCCAGGTTTGGGTATCAGG - Intronic
914238443 1:145833852-145833874 CTCTGAGAGCCTTGGCATTCAGG + Intronic
916614514 1:166425931-166425953 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
917207841 1:172596639-172596661 CTCTGAAAGCTTTGTCTCAGAGG + Intronic
917222516 1:172747192-172747214 ATCTGACAGCAGTGGCTGTCAGG - Intergenic
917246524 1:173008159-173008181 CTCTCACAGCTTTTGTTCTCTGG + Intergenic
917305627 1:173621321-173621343 CTCTGCCAGGTTTGGGTATCAGG - Intronic
917403796 1:174681746-174681768 CTCTGACAACTTTGGCACATGGG + Intronic
917568246 1:176234372-176234394 CTCTGCCAGCTTTTGGTATCAGG + Intergenic
918676040 1:187287500-187287522 CACTGAAAGCTCTGCCTCTCGGG + Intergenic
920674763 1:208031278-208031300 CTCTGAGATCTCTGGTTCTCAGG - Intronic
921043255 1:211454156-211454178 CTCTGGAAGCTTTGTCTCTGAGG - Intergenic
921753240 1:218822058-218822080 CTCTGACAGATTTTGATATCAGG - Intergenic
921976715 1:221210800-221210822 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
923762837 1:236862859-236862881 CTCAGACAGCTTTGGCCCCTAGG + Intronic
924433468 1:244017792-244017814 CACTGCCAGCTTGAGCTCTCAGG + Intergenic
1065902364 10:30220174-30220196 CGCTGCAAGCTTTGGCTCCCTGG - Intergenic
1068441426 10:57060076-57060098 CTCTGCCAGGTTTGGGTATCAGG - Intergenic
1068548841 10:58384279-58384301 CTATGAAAACATTGGCTCTCTGG - Intergenic
1070234110 10:74605718-74605740 CTCTGCCAGGTTTTGCTGTCAGG + Intronic
1071000049 10:80821326-80821348 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1071214928 10:83390135-83390157 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1071304982 10:84291605-84291627 CTAGGACAGCACTGGCTCTCTGG - Intergenic
1071763069 10:88631062-88631084 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
1072208255 10:93223483-93223505 CTCTCAGACCTGTGGCTCTCTGG + Intergenic
1072404721 10:95139558-95139580 CTCTGACAGGTTTTGATATCAGG - Intergenic
1072953165 10:99866174-99866196 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1074117435 10:110467294-110467316 CACTGATAGCTTTGCCTCCCCGG + Intergenic
1074760015 10:116660267-116660289 CACTGCAAGCTTTGCCTCTCGGG - Intergenic
1074879556 10:117644889-117644911 CTCTGACATTTTTGGATCTATGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075679562 10:124322641-124322663 CTCTGAGAGAGTGGGCTCTCAGG - Intergenic
1076705093 10:132297144-132297166 CTCTGGCTGCTGTGGCTCTGGGG + Intronic
1078337043 11:10472926-10472948 TTCTGAAACCTTTGACTCTCAGG - Intronic
1078866790 11:15305174-15305196 CCCTCACAGGGTTGGCTCTCTGG + Intergenic
1079037224 11:17030978-17031000 CTCTGACAGGCTTTGCTATCAGG + Intergenic
1080018899 11:27537886-27537908 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
1080782727 11:35445808-35445830 CTCTGACAGGTTTTGTTATCAGG + Intronic
1082011494 11:47452809-47452831 CTCTGACCCGTTGGGCTCTCAGG - Intergenic
1083044797 11:59724544-59724566 CACTGACACCTCTGACTCTCGGG - Intronic
1083499571 11:63091420-63091442 CTCTGCCAGCTTTTGGTATCAGG - Intronic
1083923360 11:65792082-65792104 GCCTGCCTGCTTTGGCTCTCTGG - Intronic
1084312357 11:68324451-68324473 CTCGGCCAGCCATGGCTCTCTGG - Intronic
1084727410 11:70950681-70950703 CACTGCCACCTTTGCCTCTCAGG + Intronic
1085594478 11:77796175-77796197 CTCTGCCAGGTTTTGCTATCAGG - Intronic
1085832933 11:79921265-79921287 CTGTGTCGGCATTGGCTCTCAGG + Intergenic
1086266599 11:85006203-85006225 CTCTGCCAGGTTTTGCTATCAGG + Intronic
1086422281 11:86648980-86649002 CTCTGACAGATTTTGGTATCAGG - Intronic
1087627114 11:100607689-100607711 CTCTGCCAGTTTTGGGTATCAGG - Intergenic
1087916723 11:103820160-103820182 CTCTGGAAGCTTTGTCTCACAGG + Intergenic
1088144943 11:106665264-106665286 CTTTTACAGCTTTGGCTTTTGGG + Intergenic
1088260554 11:107939532-107939554 CTCTGCAAGCTTTGCCTCCCGGG - Intronic
1088730140 11:112672950-112672972 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1089594352 11:119567783-119567805 TGATGACAGCTTTGGCTCTTTGG + Intergenic
1090233412 11:125127043-125127065 CTCTGGCAGCTCTGCCTCTAGGG - Intergenic
1090545143 11:127757140-127757162 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
1091152790 11:133344298-133344320 CAAAGACAGCATTGGCTCTCAGG - Intronic
1091807738 12:3367754-3367776 CTCTGGAAGCTGTGGCTCTGGGG - Intergenic
1094790950 12:33914501-33914523 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1096610393 12:52797146-52797168 CTCTGCCAGATCTGGCTTTCTGG - Intergenic
1096656521 12:53096053-53096075 CTCTGACAGCCTTGGTTCCAGGG + Intergenic
1096870058 12:54587619-54587641 CTGTGACAGCCTTGGCTCAAGGG - Intronic
1097365662 12:58709735-58709757 CTCTGGAAGCTTTGTCTCACAGG + Intronic
1097488773 12:60238292-60238314 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1097654055 12:62339861-62339883 CTCTGCCAGCTTTTGGTATCAGG + Intronic
1098752688 12:74315699-74315721 ATCTGGGAGCTTTGGCTCACTGG + Intergenic
1098980852 12:76954010-76954032 GACTGGCAGCTTTGGCACTCTGG + Intergenic
1099087511 12:78263332-78263354 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
1099910274 12:88823603-88823625 CTCTGATAGCTATGTCTTTCAGG - Intergenic
1100136615 12:91560469-91560491 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1100321479 12:93497245-93497267 CTCTGTCAGATTTGGGTATCAGG - Intronic
1101130840 12:101689752-101689774 CTCTGAGCTCTCTGGCTCTCAGG - Intergenic
1101348713 12:103908133-103908155 CACTGACAGCTCTGCCTCCCGGG - Intergenic
1102108828 12:110348742-110348764 CGCAGGCAGCTGTGGCTCTCGGG + Intronic
1102313876 12:111870266-111870288 TTCAGATAGCTTTGGCTCTGCGG + Exonic
1102665729 12:114571181-114571203 CTCTCACAGCTTTAGGTCACTGG + Intergenic
1103169069 12:118798497-118798519 CTCTGGAAGCTTTGTCTCACAGG + Intergenic
1104100338 12:125602128-125602150 CTCTGCCAGGTTTGGGTATCAGG - Intronic
1104401795 12:128482451-128482473 CTCTGTCAGGTTTGGGTATCAGG + Intronic
1104615004 12:130260078-130260100 CTCTGACAAATGTGCCTCTCAGG - Intergenic
1105283558 13:18984510-18984532 CTCTGAAAGCTTTGTCTCAGAGG - Intergenic
1105285957 13:19004254-19004276 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1106390588 13:29332035-29332057 CTCTGACAGGTTTTGATATCAGG + Intronic
1106540879 13:30689566-30689588 CTCTGACAGGTTGGACCCTCTGG + Intergenic
1107698135 13:43020886-43020908 CACTGAAATCTGTGGCTCTCAGG - Intergenic
1108799525 13:54077758-54077780 CTCTGAAAGCTATAGCTCTGAGG - Intergenic
1109374988 13:61480880-61480902 CTCTGGCAGGTTTTGCTATCAGG + Intergenic
1109421755 13:62121655-62121677 CACTGAAAGCTCTGCCTCTCAGG - Intergenic
1112906566 13:104429662-104429684 CACTGGCAGATTTGGCTCCCTGG + Intergenic
1114603926 14:23980468-23980490 CTCTGCCAGCTTTTGGTATCAGG - Intronic
1114608936 14:24023246-24023268 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
1114796486 14:25720915-25720937 CTCTGGAAGCTTTGTCTCTCAGG + Intergenic
1114928579 14:27437441-27437463 GTGTGACAGATTTGGCTCACAGG - Intergenic
1115856179 14:37632482-37632504 CTCTGGCAGCTTTGTCTCAGAGG + Intronic
1116358043 14:43956469-43956491 CTCTGCCAGATTTGGGTATCAGG - Intergenic
1116775991 14:49181337-49181359 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1118024031 14:61751000-61751022 CTCTGACCGCTGCCGCTCTCAGG - Intergenic
1119025970 14:71152448-71152470 CTCTGAGAGTTGTGGCTCACTGG + Intergenic
1122197244 14:100097716-100097738 CTCCCACAGCTCTGGCTCTCCGG + Intronic
1122204284 14:100140942-100140964 CCCAGCCAGCCTTGGCTCTCGGG + Intronic
1122475146 14:102002717-102002739 CGCTGGCAAATTTGGCTCTCTGG - Intronic
1122704540 14:103612010-103612032 CTCTGAAAGCTCTGCCTCCCAGG + Intronic
1123221263 14:106858339-106858361 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1123389076 15:19851293-19851315 CACTGCCAGCTTTGCCTCCCAGG + Intergenic
1123481157 15:20632740-20632762 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1123505229 15:20935701-20935723 GTCTTACAACTTTGACTCTCAGG - Intergenic
1123562468 15:21509397-21509419 GTCTTACAACTTTGACTCTCAGG - Intergenic
1123598713 15:21946684-21946706 GTCTTACAACTTTGACTCTCAGG - Intergenic
1123636854 15:22367625-22367647 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1124353905 15:28980722-28980744 CTCAGATTGCTTTGGCTATCTGG - Intronic
1124717502 15:32078816-32078838 CTCTGACAGGTTTTGGTATCAGG - Intronic
1125469112 15:39985328-39985350 CTCTGACAGGTTTTGGTATCAGG + Intronic
1125928510 15:43583162-43583184 CTCTGACAGAATTGGGTCTCTGG - Intronic
1125941676 15:43682997-43683019 CTCTGACAGAATTGGGTCTCTGG - Intergenic
1127560644 15:60132956-60132978 CTGTGGCACCTTTGGCTTTCTGG - Intergenic
1128326881 15:66729615-66729637 CTCTGACAGCGTGGACTCCCAGG + Intronic
1129190106 15:73932154-73932176 CTCTGCCAGCTTTGCCTCTGTGG + Intronic
1130402921 15:83574065-83574087 CTCTCACAGCCCTGGCCCTCTGG - Intronic
1131122124 15:89829231-89829253 CTCTGACAGCCTGGCCTCCCGGG - Intergenic
1132082060 15:98874611-98874633 CTTTCATAGCTTTGGTTCTCTGG + Intronic
1132413094 15:101600294-101600316 CTCTGACACCTCTGCCTCACGGG + Intergenic
1202970820 15_KI270727v1_random:236543-236565 GTCTTACAACTTTGACTCTCAGG - Intergenic
1132645029 16:995004-995026 CTCTCACAGCTGTGGGTCCCAGG + Intergenic
1136576667 16:31129364-31129386 CTCTGCCAGCTTTGAGGCTCTGG + Intronic
1137057421 16:35752328-35752350 CTCAGACTGCTATGGATCTCGGG - Intergenic
1139441565 16:66970525-66970547 ATCTGACAGCTGAGGCTCTAGGG - Intronic
1141932453 16:87215207-87215229 CTGTCACAGGTTGGGCTCTCTGG - Intronic
1145085189 17:19931804-19931826 TTCTGACAGCTCTGCGTCTCAGG - Exonic
1146692684 17:34887607-34887629 CACACACAGCTTTTGCTCTCTGG + Intergenic
1149309552 17:55380750-55380772 ATCTGACAGCTTGGTCTCCCAGG + Intergenic
1149914339 17:60594886-60594908 CTTTGACACCTTTGGGACTCTGG + Intergenic
1152646647 17:81472029-81472051 CTCTGAGGGCTTTGGCTTTTCGG - Intergenic
1156465388 18:37345428-37345450 CTCTGTGAGCTTTGGGTGTCGGG + Intronic
1156763263 18:40619703-40619725 CTCTGACAGGCTTGGATTTCTGG - Intergenic
1157019972 18:43769327-43769349 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1157055733 18:44226343-44226365 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
1157068478 18:44378771-44378793 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1157206136 18:45701427-45701449 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1157332083 18:46711500-46711522 CTCTGACAGCCATCGTTCTCTGG + Intronic
1157911712 18:51622907-51622929 CTCTGACAGCTGCGGATCTCTGG + Intergenic
1158428906 18:57365913-57365935 CTCAGACAGTTTTAGCTCTTTGG + Exonic
1158751507 18:60266320-60266342 CTTTGACATCTTTGGCCATCAGG - Intergenic
1159087883 18:63814799-63814821 CTCTGCCAGCTTTTGCTGTCAGG + Intergenic
1159415334 18:68139671-68139693 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1159832342 18:73293077-73293099 CACTGCAAGCTTTGCCTCTCGGG + Intergenic
1162796630 19:13090609-13090631 CTCTGACAGCCCTGGCCCTGGGG + Intronic
1164677964 19:30114965-30114987 CTTTCACTGCCTTGGCTCTCGGG + Intergenic
1167036818 19:46999702-46999724 CTCTGCCAGCTTTGGGACACAGG - Intronic
1168321898 19:55515654-55515676 CACTGCCAGCTTTGCCTCCCAGG - Intronic
1168488630 19:56787566-56787588 CTCTGCCAGGTTTTGCTATCAGG + Intronic
924998509 2:385473-385495 CTCAGCCAGCTCTGACTCTCAGG - Intergenic
927252823 2:21013434-21013456 CTCTAACATCTTTAGATCTCTGG + Exonic
927395577 2:22646745-22646767 TTCAAACACCTTTGGCTCTCTGG + Intergenic
928532985 2:32211125-32211147 CTCTAAAATCTTTGGTTCTCAGG + Intronic
930935876 2:56950928-56950950 CTCTGCCAGGTTTGGATATCTGG + Intergenic
932523748 2:72441917-72441939 CTCTGCCAGGTTTTGCTATCAGG - Intronic
933421535 2:82052645-82052667 GTCTGCCAGCTTTGGATATCAGG + Intergenic
933576352 2:84073110-84073132 CTAAGGCAGCTTTTGCTCTCAGG + Intergenic
935803177 2:106719285-106719307 CTCTGCCAGCTTTTGGTTTCAGG + Intergenic
936139940 2:109930670-109930692 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
936176629 2:110228615-110228637 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
936204756 2:110440816-110440838 CTCTGCCAGGTTTGGGTATCAGG - Intronic
937043413 2:118837774-118837796 CTCTGCCAGCTGTAGCTCTTGGG - Intergenic
937095082 2:119229946-119229968 CTCTGACTGCTGTGGCCCCCTGG - Intronic
937248587 2:120509826-120509848 CCCACACAGCTTTGCCTCTCAGG + Intergenic
939653158 2:144788911-144788933 CTCTGCCAGCTTTTGGTTTCAGG - Intergenic
940114760 2:150195832-150195854 CTCTGACAGGTTTTGGTATCAGG - Intergenic
940496323 2:154433459-154433481 CTCTTACAGCTTTGCCACTCTGG + Intronic
940564812 2:155347997-155348019 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
940629784 2:156223334-156223356 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
940996146 2:160152112-160152134 CTCTGCCAGCCTTTGCTATCAGG - Intronic
941869792 2:170372174-170372196 CTCTGCCAGGTTTGGATCTCAGG + Intronic
942372113 2:175296199-175296221 CTCTGACAGGTTTTGGTATCGGG - Intergenic
942899724 2:181100169-181100191 CTCTGAAAGCTTTGTCTCAGAGG + Intergenic
943125360 2:183789397-183789419 CTCTGAAAGCTTTGTCTCAGAGG - Intergenic
943152778 2:184135268-184135290 CTCTGACAGATTTTGGTATCAGG + Intergenic
943307425 2:186281075-186281097 CTCTGACAGATTTTGGTATCAGG + Intergenic
943837177 2:192528159-192528181 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
943981264 2:194554294-194554316 CTATGACATATTTTGCTCTCAGG + Intergenic
944991700 2:205245072-205245094 CTCTGTCTGCTTTGGCTTCCTGG + Intronic
945339323 2:208632765-208632787 GTCTGAAAGCTATGCCTCTCAGG - Intronic
945657970 2:212648798-212648820 CTCTGGCAGGTTTGGTTGTCTGG + Intergenic
946374911 2:219302237-219302259 CTCTGGCAGCCTTGGCACCCTGG + Exonic
946516445 2:220416878-220416900 CTCTGACAGGTGTGGCTCAAAGG - Intergenic
947593521 2:231397586-231397608 CCCTGACAGCTTAGGGACTCCGG + Intronic
947597987 2:231426035-231426057 CTCTGACAGCTCTCGCCCTCAGG - Intergenic
1168733365 20:107152-107174 CTCTGACAGATTTTGGTATCTGG - Intergenic
1172993778 20:39055030-39055052 CTCCGAGAGCTTCGCCTCTCAGG - Intergenic
1174053390 20:47782607-47782629 CTAGGAGAGCTTTTGCTCTCTGG + Intronic
1175673512 20:60927342-60927364 CTGTTCCAGCTTTGGCTGTCGGG + Intergenic
1177529084 21:22337227-22337249 CTTGGACAGCTTTGCCTCTGTGG - Intergenic
1178152207 21:29808245-29808267 CCCTTGCAGTTTTGGCTCTCAGG + Intronic
1179240602 21:39587367-39587389 CATTGACAGCTTTGTCTCTCTGG + Intronic
1179300653 21:40106446-40106468 CTCTGCCAGATTTGGGTATCAGG + Intronic
1179319264 21:40274121-40274143 CTCTAGGAGCTTTTGCTCTCTGG - Intronic
1179338519 21:40481412-40481434 CTCTGCAAGCTTTGCCTCCCGGG - Intronic
1179388638 21:40967019-40967041 ATCTGACAGCTTTTGCTACCTGG + Intergenic
1180047338 21:45314519-45314541 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
1181456369 22:23062287-23062309 CACTGTCAGCTCTGGCTCTTAGG - Intronic
1182950270 22:34368130-34368152 CTCTGCCAGCTTTTGGTATCAGG + Intergenic
1182958119 22:34446401-34446423 CACTCAAGGCTTTGGCTCTCTGG + Intergenic
1183999169 22:41659758-41659780 CACTGAAACCTTTGGCTCCCAGG + Intronic
1184161263 22:42698642-42698664 CTCTGACACCTTTGCCTCTCGGG - Intronic
1184349857 22:43936421-43936443 CTCTTACAGCATTGGCACACTGG - Intronic
1185202652 22:49517556-49517578 CTCAGACAGCCTTGATTCTCTGG - Intronic
949092455 3:44751-44773 ATTTGACAGTTTGGGCTCTCGGG + Intergenic
949155339 3:820149-820171 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
950302674 3:11894924-11894946 CTCTGGAAGCTTCGTCTCTCAGG - Intergenic
950625813 3:14246115-14246137 CTCTGCTAGTCTTGGCTCTCTGG - Intergenic
951251597 3:20400399-20400421 CTCTGACACCCTAGGCCCTCAGG + Intergenic
952237751 3:31497723-31497745 CACTGCCAGCTTTGCCTCCCAGG - Intergenic
954198751 3:49011844-49011866 TTCTGGGAGCTTTGGCGCTCTGG + Exonic
954769736 3:52955868-52955890 CTCTGACAGGTTTTGGTATCAGG - Intronic
955339598 3:58115294-58115316 CGCAGACAGCTATGGCTTTCTGG - Intronic
955453622 3:59096989-59097011 CTCTGCCAGGTTTTGGTCTCAGG + Intergenic
955630235 3:60965792-60965814 CTCTGAAAGCTTTGTCTCAGAGG + Intronic
955637314 3:61043765-61043787 CTCTGAAAGCTTTGTCTCAGAGG - Intronic
956372207 3:68575120-68575142 CTCTGCCAGGTTTGGATATCAGG - Intergenic
956386157 3:68721871-68721893 CTCTGCCAGGTTTTGGTCTCAGG + Intergenic
957032717 3:75260830-75260852 ATTTGACAGTTTGGGCTCTCGGG + Intergenic
957704056 3:83756323-83756345 CTTTGACAGCTCTGCCTCTGTGG - Intergenic
957908211 3:86584648-86584670 CTCTGCCAGGTTTGGGTATCAGG - Intergenic
958064042 3:88519894-88519916 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
958195885 3:90242280-90242302 CTGTGACAGCTTCTTCTCTCTGG + Intergenic
958419062 3:93910923-93910945 CTGTGACAGCTTCTTCTCTCTGG + Intronic
959203513 3:103278071-103278093 CTCTGTCAGGTTTTGCTATCAGG + Intergenic
959433624 3:106285573-106285595 CTCTGACAGATTTTGGTATCAGG - Intergenic
959519835 3:107312963-107312985 CTCTGACAGGTTTTGGTATCAGG + Intergenic
959694421 3:109234278-109234300 CCCTGACCGGTGTGGCTCTCAGG - Intergenic
959735318 3:109651565-109651587 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
960211542 3:114973491-114973513 CTCTGACAGTTTTGACATTCAGG + Intronic
960642849 3:119844826-119844848 CTCTGCCAGGTTTTGCTATCAGG - Intronic
964462895 3:156955841-156955863 CTCTGCCAGGTTTGGCTATTAGG + Intronic
964566996 3:158067766-158067788 CTCTGACAGGTTTTGGTATCAGG - Intergenic
966490278 3:180520111-180520133 CTCTGACAGGTTTTGGTATCTGG - Intergenic
968436802 4:596238-596260 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
969302645 4:6306261-6306283 CTCTGTCAGCTGTGTCTCTCTGG - Intergenic
970603280 4:17657249-17657271 CTCTGACAGATTTGGCCATGTGG - Intronic
970981485 4:22103814-22103836 CTCTGGGAGCCTTGGCTCTGAGG + Intergenic
971437312 4:26641183-26641205 CTCTGAAAGCTTTGTCTCAGAGG - Intronic
971690126 4:29823213-29823235 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
971771989 4:30908847-30908869 CTCTGCCAGCTTTTGGTATCAGG - Intronic
972007215 4:34124885-34124907 CTCTAACAGATTTGACTCTGTGG + Intergenic
973262447 4:48178612-48178634 CTCTTACTGCTTTGCATCTCGGG - Intronic
973732141 4:53832986-53833008 CTCAGACAACTTTGCCTCTGAGG - Intronic
974325982 4:60415862-60415884 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
974332329 4:60496856-60496878 CATTGACACCTTTGGCCCTCAGG - Intergenic
974878708 4:67727897-67727919 CTCTGTCAGCTTTTGATCTCAGG - Intergenic
975729789 4:77326971-77326993 CTCTGAAAGCTTTGTCTCAGAGG + Intronic
976278982 4:83308061-83308083 ATATTACAGCTTTGTCTCTCAGG - Intronic
976438625 4:85047212-85047234 CTCTGACAGGTTTTGGTATCAGG - Intergenic
977508689 4:97934832-97934854 CTCTGACAGGTTTTGGTATCAGG + Intronic
977954042 4:103006656-103006678 CTCTGCCAGGTTTGGGTATCAGG - Intronic
978226613 4:106342759-106342781 CTCTGACAGTTTTTGGTGTCAGG + Intronic
979181754 4:117737602-117737624 CTCTGACAGGTTTTGGTATCAGG - Intergenic
979506034 4:121498068-121498090 CTCTGCCAGGTTTGGCTATCAGG - Intergenic
979791776 4:124792484-124792506 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
982065071 4:151647317-151647339 CTCTGTCAACCTTGGCCCTCTGG + Intronic
982218205 4:153100833-153100855 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
982295001 4:153818895-153818917 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
982725231 4:158899324-158899346 CTCTGCCAGGTTTTGCTTTCAGG + Intronic
983072155 4:163280886-163280908 CAGTGACAGCTTTGGCTGCCAGG + Intergenic
983630977 4:169848983-169849005 CTCTGAACGCTGTAGCTCTCAGG + Intergenic
983690400 4:170462904-170462926 CTCTGCCAGCTTTTGGTATCAGG + Intergenic
983879131 4:172913002-172913024 CTCTGGAAGCTTTGTCTCACAGG - Intronic
983972045 4:173887565-173887587 CTCTGCCAGATTTGGGTATCAGG + Intergenic
984324704 4:178237097-178237119 CTCTGACAGGTTTTGGTATCAGG + Intergenic
985363156 4:189197278-189197300 CTCTGCCAGATTTGGATATCAGG + Intergenic
986477564 5:8151350-8151372 CTGTCACAGCTTTGTCACTCTGG + Intergenic
987225607 5:15837803-15837825 ATCTGACAGCTTCAGTTCTCTGG + Intronic
987697762 5:21354688-21354710 CTTTGACAGCTCTGCCTCTGTGG + Intergenic
988308240 5:29522894-29522916 CTCTGCAAGCTTTGCCTCCCAGG + Intergenic
988754473 5:34232006-34232028 CTTTGACAGCTCTGCCTCTGTGG - Intergenic
989194549 5:38703601-38703623 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
989540257 5:42609988-42610010 CCTTGACAGCTAAGGCTCTCAGG + Intronic
990803840 5:59635403-59635425 CTCTGCCAGCTTTTGGTATCAGG - Intronic
991027702 5:62048509-62048531 CTCTGACAGGTTTTGGTATCAGG + Intergenic
991742683 5:69697699-69697721 CTTTGACAGCTCTGCCTCTGTGG - Intergenic
991755011 5:69857505-69857527 CTTTGACAGCTCTGCCTCTGTGG + Intergenic
991794256 5:70277437-70277459 CTTTGACAGCTCTGCCTCTGTGG - Intergenic
991822073 5:70573012-70573034 CTTTGACAGCTCTGCCTCTGTGG - Intergenic
991834338 5:70732653-70732675 CTTTGACAGCTCTGCCTCTGTGG + Intergenic
991886635 5:71276979-71277001 CTTTGACAGCTCTGCCTCTGTGG - Intergenic
992288266 5:75257979-75258001 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
992572061 5:78068767-78068789 CTCTGACAGGTTTTGGTATCAGG - Intronic
992627224 5:78647453-78647475 CTCTAACAGCTCTGGCTCGCCGG + Intronic
993053050 5:82947675-82947697 CTCTGACAGGTTTTGGTATCAGG - Intergenic
993242803 5:85412837-85412859 CTCTGACAGGTTTTGGTATCAGG + Intergenic
993280608 5:85920634-85920656 CTCTCACTGCTGTAGCTCTCAGG + Intergenic
993494312 5:88590272-88590294 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
994405299 5:99338319-99338341 CTCTGACTGGTTTGGTTATCAGG - Intergenic
995995118 5:118288795-118288817 CTCTGACAGGTTTTGGTATCAGG + Intergenic
996023760 5:118620542-118620564 CTCTGACAGCTTTGGTCAGCAGG - Intergenic
996036581 5:118765090-118765112 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
996116906 5:119629965-119629987 CACTGAAAGCTCTGCCTCTCGGG + Intronic
998042610 5:138962046-138962068 TTCTGACAGTTTTCTCTCTCAGG - Intronic
998254628 5:140575289-140575311 CTCTGTCAGCCTAGGCACTCTGG + Intronic
998549526 5:143063920-143063942 CTGTGACATCTTAAGCTCTCAGG + Intronic
1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG + Intronic
1003527166 6:6908075-6908097 GTCTGTCAGCTTTGGCACTGTGG - Intergenic
1004071596 6:12303203-12303225 CTGTGATAGCTTTGGTTATCAGG - Intergenic
1004161118 6:13213769-13213791 CGCTGGCAGGTTTGGCTGTCTGG - Intronic
1004537922 6:16520656-16520678 CACTGACACCTGTTGCTCTCTGG - Intronic
1005283039 6:24294982-24295004 CTCTGCCAGGTTTGGGTATCAGG - Intronic
1005444785 6:25910885-25910907 CACTGAAAGCTTTGCCTCCCGGG - Intergenic
1005553088 6:26943716-26943738 CTTTGACAGCTCTGCCTCTGTGG - Intergenic
1009330473 6:62413340-62413362 CTCTGCCAGATTTTGCTATCAGG - Intergenic
1010322656 6:74530584-74530606 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1010956741 6:82098765-82098787 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1011063348 6:83296176-83296198 CTCTGCCAGCTTTTGGTATCAGG - Intronic
1011227807 6:85127043-85127065 CTTTCACATCTCTGGCTCTCAGG + Intergenic
1011339888 6:86302525-86302547 CTCTGCCAGATTTGGGTATCAGG + Intergenic
1011393757 6:86883401-86883423 CTCTGTCAGGTTTGGGTATCAGG + Intergenic
1011624141 6:89269918-89269940 CTGTGTCAGCTTTGGCTATGGGG - Intronic
1012687621 6:102272423-102272445 CACTGAAAGCTCTGCCTCTCGGG + Intergenic
1013038331 6:106408537-106408559 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
1013848344 6:114482446-114482468 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
1013957509 6:115857636-115857658 CTCTGCCAGGTTTTGGTCTCAGG - Intergenic
1014890576 6:126839275-126839297 CTCTGCCAGATTTTGCTATCAGG + Intergenic
1014922757 6:127231890-127231912 CTCTGACAGGTTTTGATATCAGG - Intergenic
1014960491 6:127677966-127677988 CTCTGTCAGGTTTTGCTATCAGG + Intergenic
1015882926 6:137887843-137887865 CTCTGCCAGCTTTTGGTATCAGG + Intergenic
1016814145 6:148288144-148288166 CTCTGACAGCTGGGGCCCGCGGG - Intronic
1017115423 6:150971710-150971732 TTCTCACAGTTTTGTCTCTCAGG + Intronic
1017615007 6:156237229-156237251 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
1017789609 6:157785306-157785328 CTCTGACAGGTTTTGGTATCAGG - Intronic
1019853135 7:3579199-3579221 CTCTGCCAGGTTTTGCTATCAGG - Intronic
1021208210 7:17810666-17810688 CTCTGACAGGTTTTGGTATCAGG - Intronic
1023511275 7:40956104-40956126 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1023619508 7:42055478-42055500 CTCTGCTAGCTGTGGCTCTGTGG + Intronic
1023959180 7:44912515-44912537 TTCTAACAGCTGGGGCTCTCAGG + Intergenic
1025034154 7:55582548-55582570 CTCTGGAAGCTTTGTCTCTGAGG + Intergenic
1028004744 7:85550545-85550567 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
1028329942 7:89577767-89577789 CTCTGCCAGGTTTGGCTATAAGG - Intergenic
1028518552 7:91703926-91703948 CTCTGCCAGCTTTTGGTATCAGG - Intronic
1028767299 7:94574204-94574226 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1029133966 7:98355241-98355263 CTGTGGCAGGTGTGGCTCTCAGG + Intronic
1030406455 7:109120714-109120736 CTCTCTTAGCTTTGGCTATCTGG - Intergenic
1031573163 7:123383804-123383826 CTTTGGCAGCTTTGGCCCTGTGG - Intergenic
1031677249 7:124625466-124625488 CACTGAAAGCTCTGGCTCCCGGG - Intergenic
1032956774 7:136980918-136980940 CTCTGCCAGCTTTTGGTATCAGG + Intronic
1033000958 7:137504076-137504098 CTCTTTCTGCTTTGGCTCTTAGG - Intronic
1033132255 7:138754696-138754718 CCCTGAAACCTTTGCCTCTCAGG + Intronic
1034462541 7:151205794-151205816 CCCTGAAAGCTTTGGCGCTCTGG + Intergenic
1034714765 7:153231479-153231501 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1035070279 7:156139706-156139728 CTCTCACATCTTTGTGTCTCTGG + Intergenic
1035554593 8:556786-556808 CTCTGTAAGCATTGGCTCTTTGG + Intergenic
1036624575 8:10457558-10457580 ATTTCACAGCTCTGGCTCTCTGG - Intergenic
1037249242 8:16873767-16873789 CTCTGCCAGGTTTTGCTTTCAGG + Intergenic
1038936091 8:32253667-32253689 CTCTGCCAGGTTTTGCTATCAGG + Intronic
1039657451 8:39425024-39425046 CTCTGACAGATGTTGCTCTTAGG - Intergenic
1039822705 8:41147700-41147722 CTCTGAAACCTTTGGCTCCTGGG - Intergenic
1040769304 8:50953673-50953695 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1041608659 8:59817183-59817205 CTCTGCCAGCTTTTGGTGTCAGG - Intergenic
1041718731 8:60956919-60956941 CTCTGAGAGCTTATGGTCTCAGG + Intergenic
1043067938 8:75600283-75600305 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1043955173 8:86351362-86351384 CTCCGACAGCTCTGTCTCCCAGG + Intronic
1044135575 8:88581560-88581582 CTCTGCCAGGTTTTGCTATCAGG + Intergenic
1044284001 8:90390415-90390437 CTCTGCCAGGTTTGGATATCAGG - Intergenic
1044292682 8:90491393-90491415 CTCTGGCAGCTTTGTCTCAGAGG + Intergenic
1044486779 8:92763720-92763742 CTCTGACAGATTTTGGTATCAGG - Intergenic
1045504426 8:102768585-102768607 CCCTCACAGCTTTGGCCTTCAGG - Intergenic
1046176904 8:110588228-110588250 CACTGCAAGCTCTGGCTCTCGGG + Intergenic
1046287019 8:112107363-112107385 GTCTGACAGTTTTGGAACTCTGG - Intergenic
1047129644 8:122004746-122004768 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1047152252 8:122276996-122277018 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1047168944 8:122471107-122471129 CTCTGCCAGGTTTGGGTATCAGG - Intergenic
1047237338 8:123053293-123053315 CTCTGAGTCTTTTGGCTCTCAGG - Intronic
1048305243 8:133279532-133279554 CTCAGCCACCTCTGGCTCTCTGG + Intronic
1049431239 8:142566253-142566275 CCCGGCCAGCTCTGGCTCTCTGG + Intergenic
1050296546 9:4210923-4210945 CCCTGACAGCTTTAGCTCCATGG + Intronic
1050979475 9:11991435-11991457 CACTGCAAGCTTTGCCTCTCTGG - Intergenic
1051089588 9:13390624-13390646 CTCTGCCAGGTTTTGGTCTCAGG - Intergenic
1051173421 9:14342103-14342125 CCCAGAGAGCTTTTGCTCTCGGG - Intronic
1051321756 9:15913014-15913036 CTCTGCCAGGTTTTGCTATCAGG + Intronic
1051764292 9:20505423-20505445 CTCTGACATCTCAGGCACTCTGG - Intronic
1052603463 9:30670401-30670423 TTTTGCCAGCTTTGACTCTCTGG - Intergenic
1053160093 9:35808122-35808144 CTCTGACAGTTTGGGCTGTCAGG + Exonic
1053849606 9:42276818-42276840 CTCTGCAAGCTCTGCCTCTCCGG - Intergenic
1054414641 9:64861092-64861114 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1054803792 9:69378967-69378989 CTCTGACTGCCTTGCCACTCTGG - Intronic
1055268927 9:74533666-74533688 AACTGACAGCATTGTCTCTCTGG - Intronic
1055514429 9:77021325-77021347 CTCTGCCAGCTTCTGCTCCCAGG - Intergenic
1055562456 9:77534491-77534513 ATCAGCCTGCTTTGGCTCTCTGG - Intronic
1056873997 9:90310241-90310263 CTATGAGTGCTTTGGCTCTGAGG - Intergenic
1058403197 9:104640926-104640948 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1058715507 9:107718920-107718942 CTCTGTCAGCTTTGGGACACAGG - Intergenic
1059517584 9:114910072-114910094 ATCTGAAAGCTTTGGTCCTCAGG - Intronic
1060474890 9:123979368-123979390 CTCTGCAACCTTTGGCTTTCTGG - Intergenic
1186398395 X:9233870-9233892 CTCTGACAGCTTTGGTCTTTGGG - Intergenic
1186679134 X:11853896-11853918 CTCTGCCAGGTTTGGGTATCAGG - Intergenic
1187756111 X:22528589-22528611 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1187884186 X:23873529-23873551 CACTGATACCTTTGTCTCTCAGG - Intronic
1188461726 X:30434794-30434816 CTCTTACAGCTTTGGAGTTCAGG - Intergenic
1188524187 X:31071667-31071689 CTCTCCCAGCCTTGGCACTCTGG + Exonic
1189010668 X:37043288-37043310 CTCTCCCAGCCTTGGCCCTCTGG + Intergenic
1189014154 X:37078115-37078137 CTCTGCCAGCCTTGGCGCTCTGG + Intergenic
1189035735 X:37492267-37492289 CTCTCCCAGCCTTGGCCCTCTGG - Intronic
1189037220 X:37505580-37505602 CTCTCCCAGCCTTGGCACTCTGG - Intronic
1189581335 X:42410177-42410199 CTCTGCCAGATTTTGCTATCAGG + Intergenic
1190779632 X:53580951-53580973 GTCTGGCAGCCTCGGCTCTCGGG - Exonic
1190869644 X:54414270-54414292 CCCAGAAAGCTTTGGCTCCCAGG + Intergenic
1191020601 X:55856360-55856382 CTCTGCCAGGTTTTGCTCTCAGG + Intergenic
1191132970 X:57034531-57034553 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
1191223999 X:58020872-58020894 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
1191908656 X:66123690-66123712 CTCTGCCAGCTTTTGGTATCAGG + Intergenic
1192147864 X:68693885-68693907 CTCTCCCCGCTTTGCCTCTCTGG + Intronic
1192546892 X:72021832-72021854 CCATGACAGCCTTGGCTGTCAGG - Intergenic
1192977575 X:76302780-76302802 CTCTGGCAGCTTTGTCTCAGAGG + Intergenic
1193083000 X:77424029-77424051 TCCTTACAGCTTTGGCTGTCAGG + Intergenic
1193113410 X:77752943-77752965 CTCTGACAGGTTTTGGTATCAGG + Intronic
1193271467 X:79534415-79534437 CTTTCACAGCTTTGCCTCTGTGG + Intergenic
1193788786 X:85793674-85793696 CTCTGACAGGTTTTGGTATCAGG + Intergenic
1193879017 X:86898929-86898951 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
1194772184 X:97919201-97919223 CTCTGCCAGGTTTTGCTATCAGG - Intergenic
1194930730 X:99884168-99884190 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1196368083 X:114945595-114945617 CTCTGACAGCTTTGTATTTCTGG - Intergenic
1196516139 X:116614454-116614476 CTCTGCCAGGTTTGGGTATCAGG - Intergenic
1197094583 X:122577998-122578020 CTCTGCCAGGTTTGGGTATCAGG - Intergenic
1197097996 X:122618310-122618332 CTCTGCCAGCTTTTGGTATCAGG + Intergenic
1197332896 X:125176466-125176488 CACTTACAGTTTAGGCTCTCAGG + Intergenic
1197455977 X:126675762-126675784 CTCTGTCAGGTTTGGGTATCAGG - Intergenic
1198660302 X:138961379-138961401 CTCTGGTAGCTTTGTCTCTGAGG + Intronic
1198730137 X:139719728-139719750 CTCTGTCAGTTCTGTCTCTCTGG + Intergenic
1198888812 X:141369316-141369338 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1199401804 X:147407047-147407069 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1199469496 X:148178619-148178641 CTCTGCCAGGTTTGGGTATCAGG + Intergenic
1199831048 X:151549774-151549796 CTCTGACAGGTTTTGGTATCAGG - Intergenic
1200505178 Y:4003059-4003081 CTCTGCCAGCTTTTGGTATCAGG - Intergenic
1200878842 Y:8190342-8190364 CTCTGCCAGCTTTTGGTATCAGG + Intergenic
1200974243 Y:9191370-9191392 CACTGAAACCTCTGGCTCTCAGG - Intergenic
1201050535 Y:9929031-9929053 CTCTGCCAGGTTTGGATATCAGG - Intergenic
1201381387 Y:13383516-13383538 CACTGCAAGCTTTGCCTCTCGGG - Intronic
1201952949 Y:19585809-19585831 CTCTGGAAGCTTTGTCTCTGAGG + Intergenic
1202048128 Y:20754353-20754375 CTCTTAGAGCTTTGGCTCTTAGG - Intergenic
1202136634 Y:21672253-21672275 CACTGAAACCTCTGGCTCTCAGG + Intergenic