ID: 1002935370

View in Genome Browser
Species Human (GRCh38)
Location 6:1667133-1667155
Sequence TAGGGTTCTATAGAAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002935365_1002935370 20 Left 1002935365 6:1667090-1667112 CCATTGACTCAATGAGGACAGCT 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1002935370 6:1667133-1667155 TAGGGTTCTATAGAAGAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 118
1002935363_1002935370 26 Left 1002935363 6:1667084-1667106 CCTCTACCATTGACTCAATGAGG 0: 1
1: 0
2: 1
3: 6
4: 66
Right 1002935370 6:1667133-1667155 TAGGGTTCTATAGAAGAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002935370 Original CRISPR TAGGGTTCTATAGAAGAAGC AGG Intronic
901873452 1:12152287-12152309 TAGGTTTCTACAGAAGAAAGGGG + Intergenic
902605350 1:17566113-17566135 TGGGGATCTATAGCAGACGCTGG - Intronic
908520988 1:64941845-64941867 CAGTGTTCTCTAGGAGAAGCAGG + Intronic
913276993 1:117147805-117147827 TAGGGTCATACAGGAGAAGCTGG + Intronic
916522894 1:165581256-165581278 TATGGATTTATAGAATAAGCAGG - Intergenic
917542867 1:175932522-175932544 TAGGGTTCTATATATGATGCAGG - Intergenic
922646486 1:227291871-227291893 TATGATTCTGTAGAAGAAACAGG - Intronic
923775323 1:236973055-236973077 AAGGAATCTATAGATGAAGCTGG - Intergenic
1067394346 10:45899864-45899886 TAAGGTTCAATAGAGGAAGATGG + Intergenic
1067862670 10:49868995-49869017 TAAGGTTCAATAGAGGAAGATGG + Intronic
1068224959 10:54096231-54096253 TAGGGTTCTTAAGAAGAACTTGG - Intronic
1068359948 10:55964904-55964926 TAGGGTTCTTTATAAAAACCAGG + Intergenic
1068593621 10:58876923-58876945 TAGTGTTCTATAGAACTGGCAGG - Intergenic
1068841440 10:61619248-61619270 TATGGTTCTGAAGAAGAAGAAGG + Intergenic
1069120994 10:64568744-64568766 TAGGGTTCTTCAGAATAATCTGG + Intergenic
1075534225 10:123256609-123256631 TAGGGGTCTATGTGAGAAGCAGG + Intergenic
1076055811 10:127371969-127371991 GATGGTTCTATTGAAGAAGGAGG - Intronic
1079744117 11:24103286-24103308 TAAGGATCTCTTGAAGAAGCTGG - Intergenic
1081831155 11:46116428-46116450 TAAGAGTCTATAGAAGAATCAGG + Intronic
1083505478 11:63153318-63153340 TAAGGTTCTATAGCAGAGGAGGG - Intronic
1092222041 12:6720847-6720869 TATGGTTCTATAGGAGAAAAAGG - Intergenic
1092510439 12:9149965-9149987 TGGGGGTCTATAGAAGTAGGAGG - Intronic
1096932768 12:55232638-55232660 TAGCATTCTAAAGAAGAAACTGG + Intergenic
1096979191 12:55718682-55718704 TAGGGATCTATGCAAGAAGTTGG - Intronic
1101112688 12:101501506-101501528 TAGGGATATCGAGAAGAAGCAGG - Intergenic
1101314921 12:103620312-103620334 TAGGGTTTTACAGAAAAGGCAGG - Intronic
1106328965 13:28721237-28721259 TTGGATTCTAGAGAGGAAGCAGG + Intergenic
1108894157 13:55302197-55302219 GTGGGTTGTATAGATGAAGCAGG - Intergenic
1109314347 13:60732718-60732740 TTTAGTTCTATAGAAGAAGTAGG + Intergenic
1116975200 14:51108311-51108333 TAGGATTCAAAAGAAGGAGCTGG + Intergenic
1117251330 14:53942347-53942369 TAGGCTTCTCTAGGAGAAGCAGG - Intergenic
1117629456 14:57674875-57674897 AAGAGTACTATAGAAGATGCAGG - Intronic
1119987441 14:79153955-79153977 TGGGGCTTTATGGAAGAAGCAGG + Intronic
1121599056 14:95189422-95189444 TAGGCTTCTATGGAAGAAGCTGG - Exonic
1124879224 15:33626139-33626161 TAGGGTTTTCTAGAAGATGCTGG + Intronic
1127817168 15:62621143-62621165 CAAGGTGCTATATAAGAAGCAGG - Intronic
1129100391 15:73256687-73256709 TGGGGTTCTTGTGAAGAAGCTGG - Intronic
1133896438 16:9933643-9933665 TGGGCTTCTATTGAACAAGCTGG + Intronic
1135073865 16:19376369-19376391 TTGGGTTTTATGGAAGAAGAGGG + Intergenic
1136531138 16:30870192-30870214 TAGGCTTCTAGAGCAGCAGCTGG - Intronic
1138294663 16:55875975-55875997 TTGGATTTTAAAGAAGAAGCTGG - Intronic
1144110883 17:12030912-12030934 AAGGGTTCTCTGGAAGTAGCAGG - Intronic
1146744408 17:35314754-35314776 TAGGGTTGTGCAGAAGAGGCTGG + Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149869766 17:60170908-60170930 TAGGGTGGTAAAGAAGCAGCTGG + Intergenic
1151528785 17:74690631-74690653 TAGAGTGCTAGAGAAGTAGCTGG - Intronic
1151647451 17:75443015-75443037 TAGGGAGCTAGAGAAGAAGCAGG + Intronic
1157597237 18:48871230-48871252 CTGGGTTCTATAGAAGCAGTGGG + Intergenic
1157645904 18:49270906-49270928 AGGGGTTCTATAGGAGAAGGGGG - Intronic
1157855146 18:51098573-51098595 TTGGGTTCTGTAGCAGGAGCTGG + Intergenic
1158860446 18:61586668-61586690 TAGGAAGCTATAGAAGAAACTGG + Intergenic
1159044202 18:63353446-63353468 TGGGGTTCTGTAGTAGAATCTGG - Intronic
1159329991 18:66980241-66980263 TAGTGTTCTGTAGAAGACCCTGG - Intergenic
1161916442 19:7232000-7232022 TTTGGTTTTATTGAAGAAGCGGG - Intronic
1166798607 19:45442882-45442904 GAGGTATGTATAGAAGAAGCAGG + Intronic
925540473 2:4961103-4961125 TATGGTCCTAGAGAAGCAGCAGG - Intergenic
939931773 2:148243897-148243919 TATGATTCTATAGAAAAATCTGG + Intronic
941836488 2:170026120-170026142 TAGGGTTCATTAGCAGAAGAAGG + Intronic
943566735 2:189525005-189525027 TATGATTCTAGAGAAAAAGCAGG - Intergenic
943617454 2:190109742-190109764 TAGGTTTCTTTAGAAGAAAATGG - Intronic
946116657 2:217468636-217468658 TGGGATTCTGTATAAGAAGCAGG + Intronic
946947966 2:224842223-224842245 TAGAAGTCTATGGAAGAAGCAGG - Intronic
1169006167 20:2208896-2208918 CATGGTTCTGTAGAAGAGGCAGG + Intergenic
1174714720 20:52745648-52745670 TAGGGCTCTCTAGAGGAAGGAGG + Intergenic
1175004464 20:55667416-55667438 TAGGGGACTATAGGAAAAGCTGG + Intergenic
1177760138 21:25394052-25394074 TAGGGCTCTCTGGAAGAAACAGG + Intergenic
1178412065 21:32372612-32372634 TAGGTTTCTGCCGAAGAAGCAGG - Exonic
953363700 3:42323597-42323619 TATGGTTCTAAAGTTGAAGCAGG - Intergenic
953477494 3:43218053-43218075 TATGCTTCTTTAGAAGAAGGGGG - Intergenic
954306754 3:49730517-49730539 TAGGAATCTTTAGAAAAAGCTGG + Intronic
957033262 3:75267407-75267429 TAGAGTTCAATACAAAAAGCTGG - Intergenic
957637447 3:82805380-82805402 TTGGATTCTAGAGAGGAAGCAGG + Intergenic
959911408 3:111767927-111767949 TAGGGTTATCTAGAGGAAGCAGG + Intronic
961167881 3:124776165-124776187 AAGGGTTCCATAGCAGAGGCTGG + Intronic
964224454 3:154381965-154381987 TAGGGTATGATAGAAGTAGCTGG - Intronic
966473759 3:180321394-180321416 AAGGGTTTTATGGAAGAATCTGG - Intergenic
967109213 3:186278575-186278597 TAGGGTTCTAAGGAATAAGAAGG + Intronic
967280758 3:187821391-187821413 TTGGGTTCTATAGAATAGGAAGG + Intergenic
968075322 3:195812941-195812963 TAGGGTTGTAAAGACGAAGAGGG + Intergenic
968394735 4:224313-224335 GAGGGTTATTTAGAAAAAGCAGG - Intergenic
968407085 4:350240-350262 GAGGGTTATTTAGAATAAGCAGG - Intronic
973737960 4:53891126-53891148 CAGGGCTCTATAGATGAAACGGG - Intronic
976512787 4:85930329-85930351 GGGGGTGCTATAAAAGAAGCAGG + Intronic
978458114 4:108918197-108918219 TAGGGTTCTATTGGAGCACCTGG - Exonic
980654234 4:135761168-135761190 TTGGATTCTATAGAAGAAGTAGG + Intergenic
986127996 5:4901488-4901510 TAGGGGACTGGAGAAGAAGCAGG - Intergenic
989257504 5:39381300-39381322 TGGGGTTGTATAGTAGAAGTGGG + Intronic
990061080 5:51649668-51649690 TAGGGTAATAAAGAAGAAGTAGG - Intergenic
990879233 5:60520971-60520993 TAGTGCTGTTTAGAAGAAGCTGG - Intronic
991575109 5:68094785-68094807 CAGGGTTCTAGTGAAAAAGCAGG + Intergenic
992409245 5:76489140-76489162 TAGGGTTCCATGGAACACGCAGG + Intronic
993674984 5:90806178-90806200 TAAGGTCCTATAGAAGATGGGGG + Intronic
994110287 5:95995366-95995388 TAAAGTTTGATAGAAGAAGCAGG - Intergenic
999369377 5:151044646-151044668 CAGGGTTCTAGAGAAGCACCTGG + Intronic
999620832 5:153471423-153471445 TGGGTTTCCATGGAAGAAGCTGG - Intergenic
1002935370 6:1667133-1667155 TAGGGTTCTATAGAAGAAGCAGG + Intronic
1003785920 6:9486882-9486904 TAGGGTTCTAGAGAGGAATTAGG + Intergenic
1009298761 6:61988479-61988501 TAGGGTTCAGTAGAAGAAACTGG + Intronic
1010666121 6:78631365-78631387 TAGGAGTCTATAGAAACAGCCGG + Intergenic
1016389165 6:143557856-143557878 CAGGGTTCTACGGAATAAGCTGG + Intronic
1018994341 6:168699873-168699895 CAGGGTTCTCTAGCAGACGCTGG + Intergenic
1019110348 6:169704884-169704906 TATAGTTCTATAGAATGAGCTGG - Intronic
1021969808 7:25954405-25954427 TAAGGATCTTTAAAAGAAGCAGG - Intergenic
1024534333 7:50417577-50417599 TCTGCTTTTATAGAAGAAGCAGG - Intergenic
1025753528 7:64313274-64313296 CAGGGCTCTACAGAAGAGGCCGG + Intronic
1026397469 7:69970783-69970805 TATGTTACTATAGAAGACGCAGG - Intronic
1028479099 7:91285020-91285042 TAGAGTTCTATAGAAGTTTCAGG - Intergenic
1028554901 7:92112522-92112544 TTGGATTCTAGAGAGGAAGCAGG + Exonic
1029210643 7:98905540-98905562 CAGGGTTCTATAGAAACAACCGG - Intronic
1031367705 7:120923739-120923761 TAGTTTTCAATAAAAGAAGCCGG + Intergenic
1031880178 7:127188983-127189005 TACGATACAATAGAAGAAGCTGG - Intronic
1035653165 8:1284005-1284027 TTGGACTCTATAAAAGAAGCAGG - Intergenic
1036931266 8:12958480-12958502 TAGGGTTCATCAGAAGAAGCAGG + Intronic
1037501841 8:19494157-19494179 TAGGTTTAGATAGAAGAAGAGGG - Intronic
1038246768 8:25865223-25865245 GAGGGATCTAAAGAAGAAGGTGG - Intronic
1042589216 8:70379701-70379723 TAAGTAGCTATAGAAGAAGCAGG + Intronic
1047295070 8:123563450-123563472 TTGGCTTCTATAGTAGAAGTGGG + Intergenic
1048127823 8:131656797-131656819 TAGGGTGCTTTTGAAGAAGTGGG - Intergenic
1050430957 9:5560922-5560944 CTGGGCTCTAGAGAAGAAGCTGG + Intronic
1051024595 9:12592648-12592670 TAGGGTAAGATAGAAGAAGCTGG - Intergenic
1053654728 9:40205432-40205454 TAAGGTTCAATAGAGGAAGATGG - Intergenic
1054366843 9:64351649-64351671 TAAGGTTCAATAGAGGAAGATGG - Intergenic
1054529869 9:66170878-66170900 TAAGGTTCAATAGAGGAAGATGG + Intergenic
1054674471 9:67841391-67841413 TAAGGTTCAATAGAGGAAGATGG - Intergenic
1057965110 9:99495657-99495679 TAGGGCTTTAGAGAAGCAGCTGG - Intergenic
1059830925 9:118095023-118095045 TAGTGTTCTGCAGGAGAAGCTGG + Intergenic
1190759186 X:53425601-53425623 TAGGAGTCAATAGAGGAAGCTGG + Intronic
1195315416 X:103672687-103672709 GAGGGTTGGATAGAAGCAGCAGG + Intergenic
1198266461 X:135013710-135013732 TTGGGGTCTAGAGAAGAAACTGG - Intergenic