ID: 1002944442

View in Genome Browser
Species Human (GRCh38)
Location 6:1747701-1747723
Sequence CAGGACCTCCAGTAGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002944440_1002944442 -4 Left 1002944440 6:1747682-1747704 CCTGGTATTTAGTTTGAGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1002944442 6:1747701-1747723 CAGGACCTCCAGTAGTTTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002944442 Original CRISPR CAGGACCTCCAGTAGTTTTG TGG Intronic
900638999 1:3679358-3679380 CTGGACCTCCAGTAGGGGTGCGG + Intronic
900792630 1:4690202-4690224 CAGACCCTCCAGGAGGTTTGTGG + Intronic
901521066 1:9785568-9785590 GCGGACATCCAGTGGTTTTGAGG - Intronic
903738885 1:25546628-25546650 CAGGCCCTCCGGTTATTTTGTGG + Intronic
906091093 1:43180396-43180418 CAGGACCCACAATACTTTTGAGG - Intronic
910581362 1:88829048-88829070 CAGGAACTTCAGTAGTTTCCCGG - Intronic
912570922 1:110620359-110620381 CAGGTCTTCCTGTTGTTTTGTGG + Intronic
915712847 1:157917774-157917796 TAGGACCTCCAGCAGTACTGCGG + Intergenic
917242004 1:172958776-172958798 CTTGACCTCAAGTAGTTTCGTGG + Intergenic
920546498 1:206822787-206822809 CAGGCCCTGCACTAGGTTTGGGG - Intronic
1065461263 10:25967277-25967299 CACAAACTCCAGTAGTTGTGTGG - Intronic
1067146883 10:43700841-43700863 TAGGACATTCAGTAGTTTGGAGG - Intergenic
1070159825 10:73859580-73859602 TAGGAGCTCCAGTAGTTCTGCGG + Intronic
1071366563 10:84906362-84906384 CAGGCCATCCAATTGTTTTGGGG + Intergenic
1072538187 10:96378938-96378960 CTGGACCTCCAGTTGTTGGGGGG - Intronic
1073267407 10:102236197-102236219 CCTGACCTCCAGCAGTTTGGGGG - Intronic
1075265977 10:120999807-120999829 CAGGACGTCCGGGAGTTGTGAGG + Intergenic
1075596338 10:123732371-123732393 CAGGACCCTGAGTATTTTTGGGG - Intronic
1076878196 10:133227148-133227170 CAGGGCTTCCAATGGTTTTGGGG + Intergenic
1077824550 11:5791111-5791133 GAGGAACTCCGGTAGTTTTCAGG - Intronic
1081254529 11:40876052-40876074 CAGGATTTTCAGTATTTTTGTGG + Intronic
1081354954 11:42101298-42101320 CAGGAAAGCCAGTAGCTTTGAGG + Intergenic
1083600251 11:63942885-63942907 CCGGGCCTCTAGTAGATTTGTGG - Intronic
1086205227 11:84250034-84250056 CAGGACCGCCAGTTCTTTTGAGG + Intronic
1090180176 11:124690811-124690833 CAAGTTCTCCAGTAGATTTGGGG + Intronic
1097741399 12:63246708-63246730 CAGGACATTCAGTAGTATGGTGG + Intergenic
1103289992 12:119837698-119837720 GAGGACCTACAGTTGTCTTGGGG - Intronic
1105410533 13:20167966-20167988 CATGATCTCCAGGAGTTTGGAGG - Intergenic
1108350527 13:49586556-49586578 CAGAGCCTCCAGTAATGTTGGGG - Intergenic
1113429789 13:110240285-110240307 CAGCACCTCCAGGACTTTTTTGG - Intronic
1119668909 14:76504122-76504144 TAGGACTTTCAGTTGTTTTGTGG + Intergenic
1119766058 14:77188308-77188330 CAGGTCCTCCAGTAGTTCATGGG + Intronic
1121480158 14:94261589-94261611 CAGGACCTCCAGTAAAATTAAGG + Intronic
1121866465 14:97366864-97366886 CAGGGCCTACAGTATTTTTTGGG + Intergenic
1121881355 14:97503171-97503193 CAGGACCACCAGGAGTGTTGGGG + Intergenic
1122143948 14:99677783-99677805 CAGGCCCTCCAGTACTTCTCTGG + Exonic
1124492582 15:30167321-30167343 CCGGGCCTCCAGGAGTCTTGGGG - Intergenic
1124750952 15:32371004-32371026 CCGGGCCTCCAGGAGTCTTGGGG + Intergenic
1124787927 15:32699253-32699275 CAGGACCTCCAGGTGTGTTCCGG - Intergenic
1127531697 15:59849965-59849987 CAGCACCTTCAGCTGTTTTGGGG + Intergenic
1131191911 15:90323695-90323717 CACTGCCTCCAGTAGTTTTAGGG - Intergenic
1134205022 16:12230385-12230407 CTGGACCTGCAGTAGTACTGAGG + Intronic
1138505410 16:57475941-57475963 CAGCACCTCCGGTAGATCTGTGG + Exonic
1141264388 16:82482962-82482984 CAGGACCCCCAGGGGTGTTGGGG + Intergenic
1146443128 17:32914456-32914478 CATGGCCTACAGTTGTTTTGAGG - Intergenic
1148320808 17:46750561-46750583 CTGTACCTCCAGTTGTTTTCAGG + Intronic
1152313274 17:79564044-79564066 CAGGTCCTCCATCTGTTTTGGGG - Intergenic
1155055278 18:22176949-22176971 CAGGTCCTCCAGCAGGTCTGCGG - Exonic
1156019616 18:32585049-32585071 CAGGACTTGCAGCACTTTTGCGG - Intergenic
1159973882 18:74686357-74686379 CAGGAGCACCAGGAGTTATGGGG - Intronic
1164187589 19:22884301-22884323 CTGGAACTCCAGTAGCTCTGCGG + Intergenic
1164236634 19:23343069-23343091 CAGTACCTACAGTGGTTTTGTGG - Intronic
1165705414 19:37972869-37972891 CAGGAGCTCCACTAATTTGGGGG - Intronic
929937243 2:46302330-46302352 CAGGAAATCTAGTAGTTTTTTGG + Intronic
930049918 2:47207087-47207109 TGGGACCTCCAGGAGTTTTTTGG - Intergenic
930211668 2:48645518-48645540 TAGGACATCCAATAGTTTGGAGG + Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935366469 2:102296688-102296710 CAGGACCTGCAGTTGGTTGGAGG - Intergenic
938488455 2:131741051-131741073 GAGGACTTCCAGTACTTGTGTGG + Intronic
942019485 2:171851930-171851952 CAGGATCTCCAGTACACTTGTGG + Intronic
945501340 2:210579242-210579264 CAGGACCACCATTTGTTTTAAGG - Intronic
947045138 2:225973517-225973539 CTGGACCTCCAGTATCTCTGAGG - Intergenic
948036745 2:234863853-234863875 CAGGACTTCCAGGACTTCTGGGG + Intergenic
1170532506 20:17308749-17308771 CAGGACCTCTAGCATTTCTGGGG + Intronic
1171242153 20:23580208-23580230 CAGGAACACCAGTAGTTTTTAGG + Intergenic
1177876924 21:26645159-26645181 CAGAACCTCCAGCAGTTGTAAGG + Intergenic
1182077321 22:27504003-27504025 CAAGACCTCCAGTGGCCTTGTGG - Intergenic
950525217 3:13519187-13519209 CAGGACTTCCAGTAATGCTGGGG - Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
953888442 3:46733257-46733279 CCGGACCTCCAGGAATTTGGGGG + Intronic
961172558 3:124808352-124808374 CAGGACCTCCAGAAGATGTGTGG + Intronic
962207766 3:133449078-133449100 GAGGACCTCCAACAGTTATGGGG + Intronic
967990840 3:195129401-195129423 CAGGTGGTCCAGGAGTTTTGGGG - Intronic
970131121 4:12872670-12872692 CAGCAACTCCAGGAGTCTTGAGG - Intergenic
970645169 4:18111588-18111610 CAGGCCCTCCAGTAGCTGAGTGG + Intergenic
971067253 4:23047338-23047360 CACGTTCTCCTGTAGTTTTGAGG + Intergenic
971509495 4:27406558-27406580 TAGGACTTCCAGGAGTTTTAAGG + Intergenic
974321273 4:60353431-60353453 TAGGACCTTCATTTGTTTTGTGG - Intergenic
975417443 4:74121362-74121384 CAGGATTTTCAGTACTTTTGTGG - Intronic
976122723 4:81800622-81800644 CAGGCTTTCCAGTACTTTTGTGG + Intronic
976180394 4:82393500-82393522 CAGGCTTTCCAGTACTTTTGTGG - Intergenic
976206443 4:82627226-82627248 CAGGACCTGGAATAGATTTGTGG - Intergenic
979829224 4:125280107-125280129 CAGGCCTTTCAGTGGTTTTGTGG - Intergenic
981231077 4:142356503-142356525 CAGGACCTGCAGGAGTGATGAGG + Intronic
982147438 4:152411353-152411375 CACGAACTCCAGTAGTATTGTGG - Exonic
986576043 5:9213958-9213980 CAAGAGCTCCAGTAGTATGGGGG + Intronic
995274296 5:110260724-110260746 CAGAAGCTCCAGTAGTTTTGAGG - Intergenic
995980746 5:118100145-118100167 CAGGACCTCAAGTAATTCAGTGG - Intergenic
996406288 5:123107804-123107826 CAGGAAGTCCAGTGGTTTGGTGG + Intronic
997729005 5:136151163-136151185 CAGGGCATCCAGTGGTTTTGAGG + Intronic
1001200755 5:169714117-169714139 CAGGAGCTCCAGCAGTGTTGGGG + Exonic
1002014477 5:176308625-176308647 CTGGAGCTCCAGAAGTCTTGTGG - Intronic
1002277707 5:178114222-178114244 CGGGACCTCCCGCAGCTTTGGGG + Intronic
1002944442 6:1747701-1747723 CAGGACCTCCAGTAGTTTTGTGG + Intronic
1008141911 6:47841609-47841631 CAGGAGATCCAAAAGTTTTGGGG + Intergenic
1008946388 6:57101516-57101538 CATGACCTCCATTTCTTTTGAGG - Intronic
1013342063 6:109224549-109224571 CAGGTCCAGCAGTACTTTTGTGG + Intergenic
1016377542 6:143438661-143438683 CAGGAACTTCAGTATTTTCGAGG + Exonic
1017446823 6:154514508-154514530 AAGGACATCCAGTTCTTTTGTGG - Intergenic
1018014554 6:159700303-159700325 CAGTAGCTCCAGTAATTTTCTGG + Intronic
1024043147 7:45570318-45570340 CAGGACCTTCAACAGTTATGGGG + Intergenic
1024147660 7:46533788-46533810 CAGGACATCCAGAAATTCTGGGG - Intergenic
1024794204 7:53003296-53003318 CAGAAGCTCCTGTAGTTTGGTGG - Intergenic
1028277622 7:88876515-88876537 TAGGATCTCCAGAAGTGTTGAGG - Intronic
1030148380 7:106378983-106379005 CGGGACATCTAGTAGTTTAGGGG - Intergenic
1034291576 7:149936686-149936708 CAGGACCTCCAGGTGTTTCTGGG - Intergenic
1039570044 8:38579415-38579437 CATGACCTCCAGTACTCTGGTGG + Intergenic
1041886660 8:62816912-62816934 CAGGACCTGCAAGAGTTGTGGGG + Intronic
1043383103 8:79723562-79723584 CATGACCTCCAGTAATTTAAAGG - Intergenic
1045026266 8:98089875-98089897 CTGGACCTTCAGGAGTTTTATGG - Exonic
1051335950 9:16066086-16066108 CAGGAGCTTGAGTAGATTTGGGG + Intergenic
1052558743 9:30055610-30055632 CAGATCCTACAGTAGTTTTTTGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056075520 9:83034685-83034707 CAGAAGCCCCAGTTGTTTTGAGG - Intronic
1057465077 9:95306165-95306187 AAGGACCTTCAGAAGTTTTATGG + Intronic
1058494061 9:105535394-105535416 CAGGATTTCCATTAGTATTGTGG + Intronic
1061239533 9:129361549-129361571 CAGGATCTCCAGGAGCTCTGAGG + Intergenic
1190054853 X:47175474-47175496 CAGGACTTCCAGTGGTCCTGAGG - Intronic
1193468283 X:81872305-81872327 CAGGAACTCCAGTGATTCTGTGG - Intergenic
1193665272 X:84309157-84309179 CAGAACCTCTAGAAGTCTTGAGG - Intergenic
1195351093 X:103997513-103997535 CACGAACTCCAGTAGTTTTTCGG + Intergenic
1195356405 X:104043898-104043920 CACGTACTCCAGTAGTTTTTCGG - Intergenic
1196106383 X:111900585-111900607 CAGGGTCTACATTAGTTTTGGGG - Intronic
1197167629 X:123395251-123395273 CATCACCTGCAGTTGTTTTGTGG - Intronic
1197461429 X:126746760-126746782 TAGGACCTCCAGTATTTTGTTGG + Intergenic
1198046248 X:132906054-132906076 CAAAACCTCAAGTATTTTTGTGG - Intronic