ID: 1002948150

View in Genome Browser
Species Human (GRCh38)
Location 6:1782220-1782242
Sequence CTTTTTAAATACATGTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 490}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002948150_1002948154 22 Left 1002948150 6:1782220-1782242 CCCAGTTACATGTATTTAAAAAG 0: 1
1: 0
2: 3
3: 53
4: 490
Right 1002948154 6:1782265-1782287 AAACCAATAAGCCTAAACATAGG 0: 1
1: 0
2: 0
3: 24
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002948150 Original CRISPR CTTTTTAAATACATGTAACT GGG (reversed) Intronic
902140840 1:14352981-14353003 TTTTTTAAATCCACATAACTAGG + Intergenic
903638876 1:24842854-24842876 CTTTTTAAATAGTGGCAACTTGG + Exonic
904161815 1:28527713-28527735 TTTTTTAAATACATGTGGCCAGG + Intronic
905623732 1:39472547-39472569 CATTTTATATACATATCACTTGG - Intronic
905847427 1:41244008-41244030 CTTTTAAAAGACTTGTAATTAGG + Intergenic
907083058 1:51642696-51642718 CTTTTTACATACAAATATCTAGG + Intronic
907428444 1:54396283-54396305 CTTCTTTAATACATGTTGCTGGG - Intronic
908041946 1:60123489-60123511 CTTTGTAAATATATCTAACCTGG - Intergenic
908107871 1:60864425-60864447 CTTTTTAAATACATTAATTTTGG - Intergenic
908952750 1:69581707-69581729 GTTTTTAAATATATGAAAATTGG + Intronic
909532511 1:76696949-76696971 ATTTTTAGATAAATGCAACTTGG - Intergenic
911687497 1:100793745-100793767 CGTCTTTAATACATGGAACTAGG - Intergenic
911754774 1:101540807-101540829 CTCTTCAAATACATGTCACATGG - Intergenic
911801815 1:102149303-102149325 ATTATAAGATACATGTAACTTGG + Intergenic
912188703 1:107312646-107312668 CTTTCTAAATACAGGTTCCTGGG + Intronic
912686304 1:111769104-111769126 CTTTATAAATTCAAGTAATTTGG + Intergenic
914935669 1:151977568-151977590 TTTTTTAAATGCATGAAAGTGGG - Intergenic
915794277 1:158710568-158710590 CTTTTTAAATAAATCTAAAATGG - Intergenic
917808402 1:178634727-178634749 ATTTTTAAATATATCTATCTTGG - Intergenic
919024762 1:192152798-192152820 CTTTTTAAAAACCTATAAGTAGG + Intergenic
920545588 1:206814114-206814136 TTTTTTAAATATATGCAAATAGG - Intronic
921440867 1:215184352-215184374 CTTTTTAAATATAACTAACAAGG + Intronic
921522305 1:216170926-216170948 ATTTTTAACCCCATGTAACTGGG + Intronic
921609467 1:217194184-217194206 CTTTTTGAATACATCTATCATGG - Intergenic
921689884 1:218136232-218136254 ATTTTTAAAATCATGTAAATTGG + Intergenic
921745066 1:218731143-218731165 CTCTTGAAAGACATGAAACTAGG + Intergenic
922440350 1:225651265-225651287 CATCATAAATACAGGTAACTTGG + Intronic
922590419 1:226771641-226771663 CTTTATTGATTCATGTAACTGGG + Intergenic
923154005 1:231259717-231259739 CTTCTTCACTACATGTAATTGGG + Intronic
1063044293 10:2376435-2376457 CCTTTTAAAAACATGGAACATGG + Intergenic
1063840335 10:10064621-10064643 CTTTGTAAACATATGTAAATAGG + Intergenic
1063880106 10:10522496-10522518 CTTTTCAAAAATATGTACCTTGG - Intergenic
1064175066 10:13067403-13067425 CTTTTTGAAGACATTTTACTAGG + Intronic
1064408617 10:15086436-15086458 CTTTTAAAATACTTGCAACGAGG - Intronic
1064458874 10:15514158-15514180 CTTTTTAAATTCTTGCAGCTGGG - Exonic
1064875151 10:19985505-19985527 CTTATTAAATACATGAAATGGGG + Intronic
1065398475 10:25267809-25267831 CTTTTCAAAAACATGTGAGTAGG + Intronic
1065874147 10:29982772-29982794 CTTGTTAAACACATGCTACTGGG + Intergenic
1067324478 10:45253861-45253883 CTTTTTTAATATATGTACTTAGG + Intergenic
1067834404 10:49629231-49629253 TTTATTTAATAAATGTAACTGGG - Intronic
1067884817 10:50078443-50078465 ATTTTTAAATACAAATGACTAGG - Intronic
1068452145 10:57204812-57204834 ATTTTTAAAAATATGTAACGAGG + Intergenic
1071537257 10:86444202-86444224 CTTTTACAATACAAGTAACTTGG + Intronic
1071759739 10:88588280-88588302 CTATTTAAATATACTTAACTTGG - Intronic
1072213002 10:93264028-93264050 CATTTTAAAGACATGAAAATTGG - Intergenic
1072593961 10:96854266-96854288 CTTTTTCGCTCCATGTAACTAGG - Intronic
1072807445 10:98433311-98433333 CTTGTTAAATACAGGTTACTGGG - Intronic
1072975596 10:100054940-100054962 GTTATTAAATACATTTAGCTAGG + Intronic
1073384480 10:103112603-103112625 GTTTTTGAAAACATGTCACTGGG + Intronic
1073794059 10:106969082-106969104 CTTTATTAATACATTTTACTTGG - Intronic
1073872033 10:107876698-107876720 CCTATTTAATACATGGAACTGGG + Intergenic
1074433243 10:113411345-113411367 CTGGTTAAATACCTGTAAGTGGG + Intergenic
1075224930 10:120620384-120620406 ATTTTTAAATCATTGTAACTAGG - Intergenic
1077847510 11:6041462-6041484 TCTCTTAAATACATTTAACTTGG - Intergenic
1077926765 11:6689042-6689064 CCTCTTAAATACATATAGCTTGG - Intergenic
1077971946 11:7203251-7203273 TTTTTAAAATACATATTACTTGG - Intergenic
1078544440 11:12236490-12236512 CACTTGAAATACATGAAACTTGG + Intronic
1079228478 11:18628870-18628892 TTTTTTAAATACATGGAGCTTGG + Intronic
1079229600 11:18638279-18638301 ATCTTTGAAAACATGTAACTTGG + Intergenic
1079420499 11:20282686-20282708 CTTTTTAAAAATATGTAATATGG - Intergenic
1079710312 11:23675242-23675264 CTTATTAAATAAATGTAGCTGGG + Intergenic
1079773240 11:24490748-24490770 TTTTTTAAATACATATTGCTGGG - Intergenic
1080184541 11:29465291-29465313 GTTATTAAATACATTTAGCTAGG + Intergenic
1080319459 11:30989556-30989578 CATTTAAAGTACATTTAACTAGG + Intronic
1080523783 11:33092714-33092736 TTTTTTAAATACATTGAACATGG + Intronic
1080758584 11:35226001-35226023 CTTCTTAAATTCTTATAACTAGG + Intronic
1081102342 11:39020554-39020576 CTTTTAAAAGACTTGTAATTAGG - Intergenic
1083653197 11:64216125-64216147 TTTTTTAAAGGAATGTAACTGGG - Intronic
1084349520 11:68585563-68585585 CTTTTTATATACCTTTAAATAGG + Intronic
1085431529 11:76454780-76454802 CTATTTGCATACCTGTAACTTGG - Intronic
1085494110 11:76951839-76951861 CCTTTAAAATACATGTACCAGGG + Intronic
1085667394 11:78426808-78426830 CTATTCAAACACATGTTACTAGG + Intergenic
1085895277 11:80631889-80631911 CTTTTTAAAGAAATGAACCTTGG + Intergenic
1086455080 11:86953304-86953326 ATTTTTAATTACATGTATCCTGG - Intronic
1087445009 11:98239988-98240010 CTTTTTAAAGAGTTGTAATTCGG - Intergenic
1087965522 11:104408556-104408578 CATTTTAAATATTTGTAACTGGG + Intergenic
1088040673 11:105377215-105377237 CTTCTTAAATAAAAGTAGCTAGG - Intergenic
1088807026 11:113361737-113361759 CTTTTTTCATACATGTGATTGGG + Intronic
1089186490 11:116619004-116619026 ATTTTTAAATAATTGTAACCTGG - Intergenic
1089545057 11:119217692-119217714 TTTTTTAAATAAATGGAAGTTGG + Intronic
1090755048 11:129783220-129783242 CTTTTAATATACCTATAACTTGG + Intergenic
1091455123 12:601167-601189 CATTTAGAATGCATGTAACTAGG + Intronic
1091662172 12:2392640-2392662 CTTTTTAAACCCAGGTATCTTGG - Intronic
1091708453 12:2717764-2717786 CTTTTTTGATACGTGTAAATGGG - Intergenic
1092296250 12:7201383-7201405 CTTTTAAAATATATGTATATAGG + Intronic
1092745188 12:11666481-11666503 CTCTTTAAATAAATGTCACTGGG - Intronic
1093163328 12:15775466-15775488 ATTGTAAAATACATGTAATTTGG + Intronic
1093612311 12:21176471-21176493 CTTTTTAAAAAGGTGAAACTAGG + Intronic
1093921852 12:24867511-24867533 GTTTTTAAAGACATTTAACATGG - Intronic
1093990496 12:25584674-25584696 CTTTTAAAATACAACTAACAGGG + Intronic
1094412081 12:30177230-30177252 CCTTTTAAATAAATGGCACTGGG + Intergenic
1094689685 12:32756479-32756501 TATTTTAAATACAGTTAACTAGG + Intergenic
1094709886 12:32951246-32951268 TATGTTAAATAAATGTAACTAGG - Intergenic
1095225192 12:39670752-39670774 TTTTTTAAATTCATCTGACTGGG + Intronic
1095840616 12:46687764-46687786 CTTTTTAAAAAAATGTACCTAGG + Intergenic
1095852338 12:46824492-46824514 CTTTTTAAATCAGTGAAACTTGG - Intronic
1096655815 12:53091402-53091424 CTATTTATGTAGATGTAACTGGG - Intergenic
1097325716 12:58274298-58274320 TTTTTAACATAAATGTAACTCGG - Intergenic
1097887807 12:64747439-64747461 ATTTTTAAATACATGCTCCTGGG + Intronic
1098109980 12:67111685-67111707 CTTTTTAAATAAAAGTCACTTGG - Intergenic
1098110447 12:67116024-67116046 CTTTTTAAATACATATTATAGGG - Intergenic
1099145197 12:79034844-79034866 CTTTTGATATACCTGTAAGTTGG + Intronic
1099149650 12:79094326-79094348 CTTTTCAAGTTCATGTGACTTGG - Intronic
1099323003 12:81175356-81175378 CTTTTTTAATATATTTAATTTGG - Intronic
1099392306 12:82097036-82097058 TTTTTTAAATTTATTTAACTTGG + Intergenic
1099440557 12:82694061-82694083 TTTTTTTAATACAGGTAAATGGG + Intronic
1099749178 12:86749844-86749866 CTATTAACATACATGTAACTTGG - Intronic
1099968774 12:89479024-89479046 CATTTGAAATACATGTATGTAGG - Intronic
1100246824 12:92766539-92766561 CTTTTTAAAAACATGCTTCTGGG + Intronic
1100449028 12:94687820-94687842 CCTTGTATATACTTGTAACTGGG + Intergenic
1101287622 12:103331791-103331813 CTATTTAATTCCATGTATCTAGG - Intronic
1102223219 12:111208948-111208970 CTTTTTAAATACACTTATTTAGG + Intronic
1102589171 12:113944396-113944418 CTTTTAAAATGCATGCATCTGGG - Intronic
1102717578 12:114987365-114987387 CTTCTTAAATATATGTGAGTTGG - Intergenic
1106977331 13:35236128-35236150 CTTTTTAAATGCCAGTGACTTGG + Intronic
1107351379 13:39518376-39518398 TTTTTGAAACACATCTAACTGGG - Intronic
1107740980 13:43450349-43450371 CTTTTTAAGAAAATGTACCTGGG + Intronic
1108387055 13:49908763-49908785 CTTTTTATATATATGTAAGTAGG - Intergenic
1109044564 13:57392959-57392981 CTTTTAAAAAATATGTAAATTGG - Intergenic
1109294939 13:60518597-60518619 CTTTGTAAATACATGTAAAAAGG + Intronic
1109746073 13:66624209-66624231 TTTTTTAAACAAATATAACTAGG - Intronic
1110084113 13:71355500-71355522 ATTTTAAAATACATGTAATACGG - Intergenic
1110232852 13:73184606-73184628 CTTTTAAAATATATGTATTTTGG + Intergenic
1110240070 13:73257051-73257073 GTATTTAAATTCATGTAATTTGG - Intergenic
1110785100 13:79514821-79514843 CTTTTTAAAAAAATGTAAGGGGG - Intronic
1110877807 13:80532044-80532066 CATTTTAAATACATTTATATGGG - Intergenic
1111926204 13:94465505-94465527 GTTTTTAGAAACATGTAAATAGG + Intronic
1113635581 13:111916885-111916907 CTTTTGAAATCCATGTGACTTGG + Intergenic
1114372908 14:22110159-22110181 CTTTTGAAATGCATGCCACTGGG - Intergenic
1114760592 14:25309433-25309455 ATTTTTAAATATATTTAAGTTGG - Intergenic
1114917166 14:27283140-27283162 ATTTTTAAGTTCATGTAACTTGG + Intergenic
1114975855 14:28098495-28098517 ATTTTTAAATACTTTTAATTTGG + Intergenic
1115038762 14:28894023-28894045 ATTTTTAAGTGCATATAACTAGG - Intergenic
1116266276 14:42694518-42694540 GCTTTAAAACACATGTAACTGGG - Intergenic
1116342055 14:43736575-43736597 CTATATAAATACAAGTAACCAGG + Intergenic
1116474289 14:45321991-45322013 CTTTTGAAATAATTGTAAATGGG + Intergenic
1116819497 14:49613935-49613957 AATTTAAAATACATGTCACTTGG - Intronic
1116874640 14:50098842-50098864 CCTATTACATACATGTAACCAGG + Intergenic
1117270186 14:54135654-54135676 TTTTCGAAGTACATGTAACTGGG + Intergenic
1119454011 14:74738487-74738509 ATTTTCCAATACATGTAACAAGG + Exonic
1119637307 14:76285396-76285418 CCTTTTCAATATATGGAACTGGG - Intergenic
1120779261 14:88471462-88471484 CCTCTTAAATACATGGGACTGGG + Intronic
1121352808 14:93186783-93186805 CTTTTTAAAAACATGTGATTAGG + Exonic
1121372553 14:93373876-93373898 GTTTTTAAATACACATCACTGGG - Intronic
1122225487 14:100274927-100274949 CTTTTTAAATACTGTTAAATGGG + Intronic
1123912936 15:24987521-24987543 CTTTTTAAACACAGTTTACTGGG + Intergenic
1123929790 15:25160328-25160350 CTTTGTGAATAATTGTAACTGGG - Intergenic
1123957736 15:25356994-25357016 CATTTAAAATATATGTAATTAGG + Intronic
1124218637 15:27830878-27830900 CTTTCTATATGTATGTAACTTGG - Intronic
1124834550 15:33182933-33182955 CTTTTTACAGACAGGAAACTGGG + Intronic
1125113203 15:36058066-36058088 TTTTTTTATTAGATGTAACTGGG - Intergenic
1125251514 15:37710488-37710510 ATGTTTAAATACTTGTAATTAGG + Intergenic
1126214628 15:46140774-46140796 CTTTTAAAAGATGTGTAACTGGG - Intergenic
1126408010 15:48342718-48342740 TTTGTGAAAGACATGTAACTTGG + Exonic
1126489649 15:49222810-49222832 ATTTTTACATATATGTAAATAGG + Intronic
1126826962 15:52561052-52561074 CTTTTTAAAAACATGCAAAGTGG + Intronic
1127110018 15:55658905-55658927 TTGTGTAAATACATCTAACTGGG - Intronic
1127524230 15:59776233-59776255 ATTTTTAAAAATATGTAAATAGG + Intergenic
1127660699 15:61097703-61097725 TTTTTAAAATACATCTATCTGGG + Intronic
1129032142 15:72627171-72627193 CTTTTTAAATACATTTATTTAGG - Intergenic
1129084067 15:73069718-73069740 CTTTCTAAATATGTGTAACATGG - Intronic
1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG + Intronic
1129406910 15:75325911-75325933 CTTTTTAAATACATTTATTTAGG - Intergenic
1129470111 15:75748775-75748797 CTTTTTAAATACATTTATTTAGG - Intergenic
1129734913 15:77954361-77954383 CTTTTTAAATACATTTATTTAGG + Intergenic
1129840678 15:78741635-78741657 CTTTTTAAGTACATTTATTTAGG - Intergenic
1130170016 15:81501614-81501636 CTGTTTTAATTCATGTAAATTGG - Intergenic
1131267904 15:90929241-90929263 CTTTTTAAATCAATTTAATTTGG - Intergenic
1131301109 15:91200408-91200430 CTTTTTGAATGCATTTACCTGGG + Intronic
1132042842 15:98539450-98539472 CATTTTAAATACATGGTGCTAGG + Intergenic
1132673411 16:1111821-1111843 CTTTTTAAATACAAGGAAAAAGG + Intergenic
1134029440 16:10979989-10980011 ATTTTTAAAGTTATGTAACTGGG - Intronic
1134297051 16:12955665-12955687 CCTTTTAAATAAATGGTACTGGG + Intronic
1138056884 16:53844423-53844445 CTTTATAAGAACATGTAACTAGG + Intronic
1138368090 16:56499883-56499905 CGATTCAAATACATGAAACTGGG + Exonic
1140190953 16:72816051-72816073 CTTTTTACATAGCTGTAACATGG - Intronic
1140347719 16:74230363-74230385 CCTTTTAAGTACATTTAACCTGG + Intergenic
1140668634 16:77251641-77251663 TTTTCTAAATACAAGTATCTGGG - Intronic
1140747087 16:77990032-77990054 CTTTTTATATGGATGTAACCGGG - Intergenic
1141274330 16:82572572-82572594 ATTTTCAAATAAAAGTAACTAGG + Intergenic
1142561082 17:809370-809392 GGTTTTAAATACTTGCAACTAGG - Intronic
1143735364 17:8908502-8908524 TATTTTAAATACATGTGATTTGG - Intronic
1144934890 17:18889504-18889526 CTTTGAAATTACATGTAATTAGG + Intronic
1146549491 17:33768304-33768326 CTTTTTAAAAAAATGTATATGGG - Intronic
1146722767 17:35134749-35134771 CTCATTAAATCCGTGTAACTAGG + Intronic
1147219766 17:38921485-38921507 CTTTTTAAATACAGGTTTGTAGG - Exonic
1149056102 17:52367941-52367963 CTTTTTATTTACATGTTAGTTGG + Intergenic
1150736417 17:67744080-67744102 TTTTTTAAAAATATGTAACTGGG + Exonic
1150886808 17:69096422-69096444 CTTTTAAAAAACAAGTAACCTGG + Intronic
1153203150 18:2667373-2667395 CTTTGCAAATACATATAGCTAGG + Intronic
1153537620 18:6119140-6119162 CTCTTTCACTACCTGTAACTTGG - Intronic
1154148444 18:11886207-11886229 ATTTCTAAATACATTTAAGTTGG + Intronic
1155123673 18:22849017-22849039 CTTTTTACATACTTGTGACAAGG - Intronic
1155789085 18:29941827-29941849 CTTTTTCAAAATAAGTAACTAGG + Intergenic
1155973074 18:32100053-32100075 CTTTTTAAATTAAGGTAAATTGG + Intronic
1157341985 18:46787137-46787159 CTTTCTAAATTCAGGTAATTTGG + Intergenic
1157915535 18:51660400-51660422 GTTTATAAGTACATGCAACTCGG - Intergenic
1158110367 18:53933917-53933939 CATTTTAAATTTATGAAACTTGG - Intergenic
1158317328 18:56226070-56226092 ATTTTGAAATACTTGAAACTTGG + Intergenic
1158838861 18:61361477-61361499 CTTTTGAAATACATGTATAAGGG + Intronic
1159246945 18:65818813-65818835 CATTTAAAATACATGTAGTTTGG - Intronic
1159249098 18:65850465-65850487 CTCTGTAAATACATGTAGCGAGG + Intronic
1159443507 18:68511058-68511080 GTTTTTAAATACATGAACTTTGG - Intergenic
1160024285 18:75205532-75205554 CTTTTTAAGTACATATAAGCTGG - Intronic
1160110302 18:76022724-76022746 CATTATAAATAAATGTGACTTGG - Intergenic
1160576067 18:79854374-79854396 CTTTTAAAATAAACGTAACCAGG - Intergenic
1161196757 19:2991061-2991083 CATATTAAATATATGTAAATAGG + Intronic
1161778349 19:6276048-6276070 CTGGTTAAATACAAGTAACTAGG - Intronic
1163558148 19:18004078-18004100 CTCTTTAAATACATAAAAATTGG + Intronic
1164070517 19:21763913-21763935 TTTTTTAAATAAATTGAACTTGG + Intronic
1164854320 19:31509400-31509422 ATTTTTAAAAGCATGTTACTGGG - Intergenic
1165897186 19:39149554-39149576 CTTTTAAAATATATGTATATAGG + Intronic
1166330817 19:42077005-42077027 TTTTTTAAGTACAGGTAATTAGG + Intronic
1166764898 19:45246916-45246938 TTTTTTAAATAAATAAAACTGGG + Intronic
925006405 2:446143-446165 TTTTTTAATTACATGCAACACGG - Intergenic
925190943 2:1882908-1882930 ATTTTAAAATGCATGTAACCAGG + Intronic
926078812 2:9966674-9966696 CTTTTGAAAATCATGTGACTGGG + Intronic
927229362 2:20805334-20805356 CTTTATAAATACATGGAATTAGG - Intronic
928085910 2:28346283-28346305 ATTATTTAATAAATGTAACTTGG - Intergenic
928187778 2:29129316-29129338 CTTTTCAAGTTCATGTGACTTGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929538041 2:42797086-42797108 CTTTACAAGAACATGTAACTAGG - Intergenic
930331160 2:49986373-49986395 CTTTTTAAATTTATGTTAATGGG - Intronic
931049391 2:58393661-58393683 TTTATTCAATACATGGAACTTGG - Intergenic
931621810 2:64218080-64218102 CTTTTTAAAAACGGGTATCTGGG + Intergenic
932032507 2:68205033-68205055 CTTTTTAAATAAATGGAAAAGGG - Intronic
932254359 2:70271026-70271048 ATTTTTAAAAAAATATAACTGGG - Intronic
932630388 2:73337506-73337528 TTATTTAAATACAAGTAAATTGG - Intergenic
934167607 2:89309048-89309070 CTTTTTAAATTCTTAAAACTGGG + Intergenic
934199677 2:89873535-89873557 CTTTTTAAATTCTTAAAACTGGG - Intergenic
935507554 2:103925075-103925097 CTGATTAAATACATTTAACAGGG - Intergenic
935744325 2:106177494-106177516 CTTTAAAAATGCATGTAGCTAGG - Intronic
935841310 2:107114292-107114314 AATTTTAAATATCTGTAACTTGG + Intergenic
938186421 2:129236224-129236246 CATTTTCAACACATGAAACTTGG - Intergenic
938700706 2:133876584-133876606 CCTTTTAAATACATATAGTTTGG + Intergenic
939013333 2:136872867-136872889 CTTTATAAATCCAAGTAGCTGGG - Intronic
939015235 2:136895434-136895456 CTTTTTAATACCATGTAAATGGG + Intronic
939055475 2:137360107-137360129 CTTTTTTAATGAATGTAACAGGG + Intronic
939144375 2:138395170-138395192 CTTTTTCAATAAATGGTACTGGG + Intergenic
939208327 2:139137959-139137981 CTTTTTAAATACAAGAACCAGGG - Intergenic
939297383 2:140285762-140285784 CTTTCTAAATAAAAGTATCTGGG - Intronic
939324501 2:140671031-140671053 CATTTTAAATATATCTAAATTGG + Intronic
939710659 2:145515305-145515327 CTTTTTATTTATATGTTACTGGG - Intergenic
939745949 2:145967732-145967754 CTTTTTAAAGTGATTTAACTTGG + Intergenic
940038497 2:149334138-149334160 CTTTTTCATTACATGTATCCAGG - Intronic
940400434 2:153242636-153242658 CCTTCTAAATACATATAGCTTGG - Intergenic
941722461 2:168826519-168826541 CTTTTAAAGTAGAAGTAACTTGG - Intronic
941737343 2:168993371-168993393 CATTTTAAATATAAGAAACTAGG - Intronic
942701586 2:178717291-178717313 CTTTTAAATGTCATGTAACTGGG - Exonic
942702539 2:178729978-178730000 ATTTTTAAAAACAGGTCACTGGG + Intronic
942862341 2:180630122-180630144 TGTTTAAAATACATGTTACTTGG - Intergenic
942964081 2:181868693-181868715 GTGTTTAAATACATGGAAATGGG - Intergenic
943361661 2:186926117-186926139 ACTTTTAAATACATGTAATGAGG + Intergenic
943575051 2:189621956-189621978 GTTTTTTAATACATGTATTTTGG + Intergenic
943879217 2:193117618-193117640 CTTTTTAATTACATATAGTTGGG + Intergenic
943924496 2:193755580-193755602 TTTTTTAAATAAATGTCATTTGG + Intergenic
943993322 2:194726481-194726503 GTTTTTAAAAACATATAATTGGG + Intergenic
944082583 2:195805149-195805171 ATTTTTAAAAACATTGAACTGGG + Intronic
944354290 2:198767206-198767228 CTTTTTGAATGCGTTTAACTAGG + Intergenic
944634643 2:201663429-201663451 TTTTTAAAATACATTTTACTGGG + Intronic
945638887 2:212397172-212397194 CTTTTAAAATACATATTGCTAGG + Intronic
945753089 2:213812752-213812774 TTGTTTTATTACATGTAACTAGG + Intronic
945918770 2:215732944-215732966 CCTATTAAATAGATGTATCTTGG - Intergenic
946254537 2:218433133-218433155 CTTTAGAAATACGTGTAATTGGG + Intronic
946707385 2:222471859-222471881 CTTTTTAGTTTCATGTAACAGGG + Intronic
946821874 2:223638322-223638344 CTTTTTAAAAAAACGAAACTTGG - Intergenic
947265189 2:228271167-228271189 CTTATTCAATACATGAAAATAGG - Intergenic
947414230 2:229877005-229877027 TTTTTAAAATACATGATACTAGG + Intronic
947694341 2:232171189-232171211 ATTTTTCAAAACATGTTACTAGG + Intronic
948651439 2:239447476-239447498 ATTTTTAAATAAAAATAACTTGG - Intergenic
948851421 2:240709138-240709160 CCTTTTCAATAGATGGAACTAGG + Intergenic
1169312473 20:4556669-4556691 ATTTTTCAATACTTGTGACTGGG - Intergenic
1169556176 20:6752607-6752629 TTTTTTAAATAAATATATCTTGG - Intergenic
1169818905 20:9687577-9687599 CTTTTGAAAAACATGAAACCTGG - Intronic
1169971946 20:11278006-11278028 GTATTTAAACACATGTGACTGGG - Intergenic
1171058654 20:21933850-21933872 TTTTTTAAATAGATGTTATTGGG - Intergenic
1171161544 20:22929079-22929101 TTTTTTAAATAAAGGAAACTGGG + Intergenic
1173720891 20:45257047-45257069 CTTTATGAAAACAGGTAACTAGG - Intergenic
1175459814 20:59144087-59144109 TTTTTTAAAATCATGTAATTTGG + Intergenic
1175777388 20:61661983-61662005 CTTTTAAAAAACATGTACCCTGG - Intronic
1176979662 21:15366477-15366499 CTTTTTCAGTAAATGTATCTGGG + Intergenic
1178330303 21:31684961-31684983 TTTTTTAAAAAAATCTAACTTGG + Intronic
1178434945 21:32549929-32549951 CATTTTCAATACAGGTGACTCGG + Intergenic
1179392533 21:41006965-41006987 GTTTCGAAATACATGCAACTTGG + Intergenic
1180577851 22:16797078-16797100 CCTTTTAAATAAATGAATCTAGG + Intronic
1183126622 22:35788121-35788143 TTTTTAAAATACTTCTAACTAGG + Intronic
1183223878 22:36535980-36536002 CTTGTCAAATACAGGTTACTGGG - Intergenic
1184898996 22:47432452-47432474 ATTTTTTAATAAATGTTACTCGG - Intergenic
949998582 3:9638830-9638852 CCTTTTAAATACATATGGCTTGG + Intergenic
951234807 3:20221879-20221901 TTATTTCAATATATGTAACTTGG - Intergenic
953260601 3:41335368-41335390 CTTATTAAATAAATGAAAATAGG - Intronic
953559011 3:43970678-43970700 CTTTTTAAATACAGGTTTGTGGG + Intergenic
953724549 3:45386707-45386729 CTTGTTAAAGACATGGAAATGGG + Intergenic
953742619 3:45550464-45550486 TTTTTCAAAAACATGTAGCTTGG + Intergenic
955641051 3:61084650-61084672 CTTTTTAAATACATTTATTGAGG + Intronic
955679927 3:61489696-61489718 TTTTTTAAAAACATGTAAGCTGG - Intergenic
955737277 3:62052777-62052799 CTTTTTAAAGTCAAGTAACAAGG - Intronic
955880081 3:63534039-63534061 CTATTTAAATACAAGTTTCTAGG - Intronic
957239249 3:77637156-77637178 CTTTAAAATTACCTGTAACTGGG - Intronic
957295634 3:78329340-78329362 TTTCTTAAATGCATGTAAATAGG - Intergenic
957404168 3:79755570-79755592 TTTTTTAAATAGATGTAATTTGG - Intronic
957409152 3:79815113-79815135 CATTTTAAACACATATTACTAGG - Intergenic
957539039 3:81545003-81545025 ATTTTTATATACATGTAAACTGG - Intronic
957670715 3:83298599-83298621 AGTTTTAAAAACATGTCACTTGG + Intergenic
957773601 3:84726692-84726714 CTTTTTAAATGCATTTAAGTAGG + Intergenic
957982672 3:87530402-87530424 CTATTTAAAATAATGTAACTAGG + Intergenic
958718436 3:97816083-97816105 TTTTTTAAAGACATATAGCTAGG + Intergenic
959036518 3:101372184-101372206 ATTTTTAAATACATGCTAGTTGG - Intronic
959764944 3:110014385-110014407 TTATATAAGTACATGTAACTTGG + Intergenic
959889764 3:111541410-111541432 CTCTGTAAATAGAAGTAACTAGG + Intronic
959944674 3:112114389-112114411 TTTTTTTAATTCCTGTAACTGGG - Intronic
962113787 3:132479722-132479744 CTTTTTAAAGACATTTTAATAGG + Intronic
962991347 3:140580199-140580221 CTTTTTAAACAAATGTTACAGGG + Intergenic
963452250 3:145497197-145497219 GTTTTTAACCACATGTAACCTGG + Intergenic
964057305 3:152477101-152477123 ATTATTCAACACATGTAACTTGG + Intergenic
964372535 3:156016003-156016025 CAATTTAAATACATGTAACTAGG + Intergenic
965215820 3:165863456-165863478 TTTTTTAAATCCATCTAACATGG + Intergenic
965370134 3:167851988-167852010 CTTGTTAAACACAGGTTACTGGG - Intergenic
965638408 3:170808020-170808042 CTTTTAAAATAAATGTTAGTGGG + Intronic
965822634 3:172699958-172699980 CTACCTAAATACATGTAACTTGG + Intronic
965899736 3:173623909-173623931 CCTTTTAAATAGATGTCAATGGG - Intronic
965925007 3:173967404-173967426 CTTTTGAAATAGATGTAGCTAGG + Intronic
966170804 3:177078114-177078136 CTTTTTAAATGCTTATAATTTGG - Intronic
966173726 3:177112626-177112648 CGTTTTAAAAACAAGTAATTAGG + Intronic
966199738 3:177349411-177349433 TTTTATAAATTCATGCAACTGGG + Intergenic
966241015 3:177755496-177755518 CTTTTTAAAGACAAGTCATTTGG + Intergenic
966601636 3:181781284-181781306 TTTCTTAAATACATAGAACTTGG - Intergenic
967017139 3:185492678-185492700 CTTTTAAAATACAGGTTCCTGGG - Intronic
967302352 3:188027324-188027346 CTTCCTAAATTCAAGTAACTAGG + Intergenic
967585880 3:191214599-191214621 CTTTTAAAATACTTGTAGCCTGG - Intronic
967646616 3:191931606-191931628 ATTTTTATATACATCCAACTAGG - Intergenic
968243037 3:197109975-197109997 CTCTTTAAATTAATTTAACTTGG + Intronic
968344294 3:197987747-197987769 CTTTTAAAAAAAATGTAACATGG - Intronic
969974086 4:11080393-11080415 TTTTTTAAATACATTGAATTAGG + Intergenic
970586002 4:17514944-17514966 CTATTTAAATACTTGAAACGAGG + Intergenic
970773439 4:19643156-19643178 CCTTTTAAATAAATGTTGCTGGG - Intergenic
971187228 4:24391118-24391140 CTTTTTAAAAATATGTTCCTGGG + Intergenic
971236842 4:24849980-24850002 CTTCTCAAATACATGTATCTGGG + Intronic
971505560 4:27362705-27362727 TTTTTAAAATACATGCAACTGGG - Intergenic
971808525 4:31393423-31393445 CTTTTTAAACAAATAGAACTTGG + Intergenic
971823333 4:31588181-31588203 CTTATTAAATCAATGTAACTTGG - Intergenic
972057490 4:34822473-34822495 TTTTTTAAATAAATGTAGCAAGG - Intergenic
972555555 4:40177313-40177335 CTTTTTAAATACTTCTTCCTGGG + Intergenic
972926152 4:44010296-44010318 CTTTTATAGTACATGTTACTGGG - Intergenic
973064943 4:45778193-45778215 CTCTCAAAATACATGTAACTTGG + Intergenic
973693280 4:53463347-53463369 CTTTTTAATTAAATAAAACTAGG - Intronic
974613852 4:64255090-64255112 ATTTTTAATTACATGTAACCTGG - Intergenic
975334857 4:73164346-73164368 CTATTTTAATAAATGTAACTAGG + Intronic
975432699 4:74313753-74313775 TTCCTTAAATCCATGTAACTAGG + Intronic
975511319 4:75196223-75196245 AATTTTAAATAATTGTAACTAGG + Intergenic
975636327 4:76453016-76453038 CTTATTAAAAACATATATCTAGG - Intronic
975748387 4:77496697-77496719 CTTTTTAAAAAAATTTAAATTGG + Intergenic
977117308 4:93046480-93046502 CTTTTTATATACATACAACAAGG - Intronic
977869738 4:102077331-102077353 CATTTTACATATATGTAAGTTGG + Intergenic
978937084 4:114390665-114390687 ATCTATAAATACATTTAACTGGG - Intergenic
979049764 4:115915828-115915850 ATTTTAAAATACATTTAATTGGG - Intergenic
979053933 4:115972736-115972758 CTTTTAAAATATAATTAACTTGG + Intergenic
979263762 4:118677904-118677926 CTTTAAAAATACCTATAACTAGG - Intergenic
979276235 4:118817168-118817190 TTTTTAAAATAGATGTAACTAGG - Intronic
980319674 4:131254368-131254390 CTTGTTTAATACAGGAAACTGGG + Intergenic
980786812 4:137566715-137566737 CTTTTAAAATTCATCTATCTAGG + Intergenic
981946798 4:150355904-150355926 CATTTTAAATCCATGTAATACGG + Intronic
981949679 4:150391106-150391128 CTTTTTAAAAGAATGTGACTAGG - Intronic
982538334 4:156635755-156635777 CTTTTTAAAATCTTGTAACTAGG - Intronic
982628963 4:157807419-157807441 CTTTTTCAATATATGAATCTAGG + Intergenic
982954846 4:161751329-161751351 CTTTTTGAATACATGTTTATAGG + Intronic
983893829 4:173059926-173059948 CAGTTTGAATACATGTATCTTGG - Intergenic
984464556 4:180081448-180081470 CCTTTTAAAAATATGTTACTTGG + Intergenic
986186341 5:5444702-5444724 CTATCTAAATACATGTTTCTTGG - Intronic
986231246 5:5866542-5866564 GTTTTTAAATAAAAGTAATTGGG - Intergenic
987256613 5:16160775-16160797 CTTTTTAAGTAAATGGAACCTGG + Intronic
987777042 5:22381356-22381378 ATTTTTAAAATCATGTAAATAGG + Intronic
988079055 5:26392768-26392790 CTTTTTAAAAACAAATAACCTGG - Intergenic
988670073 5:33371739-33371761 CTATTTACATAGTTGTAACTTGG - Intergenic
988899462 5:35717155-35717177 CATTTTAACTTGATGTAACTTGG - Intronic
989340630 5:40370401-40370423 CTTTTTCAATAAATGTTGCTGGG + Intergenic
989565477 5:42897194-42897216 TTTTTAAAATAAATATAACTTGG + Intergenic
989628672 5:43458400-43458422 CTTTTTAAAAACATATTTCTAGG - Intronic
989691420 5:44149451-44149473 CTTTCTAAATACATGTCAGATGG + Intergenic
991239639 5:64442703-64442725 CCTTTTAAATACACATAGCTTGG - Intergenic
991246379 5:64512657-64512679 CTTTTTATATAAATGTATCTCGG - Intronic
991408742 5:66326546-66326568 TTTTTTAGATACAAATAACTTGG - Intergenic
992478321 5:77125617-77125639 CTTTTTAAAGACAAGAAATTTGG + Intergenic
993693378 5:91030851-91030873 CTTTTCAAAAACATGTAATTAGG - Intronic
993988185 5:94622202-94622224 CTTATTCAAAACATTTAACTGGG - Intronic
993993779 5:94693764-94693786 TTTTTTAAACAGAAGTAACTTGG + Intronic
994133113 5:96253773-96253795 CATTTCAAATACATTCAACTGGG - Intergenic
994377373 5:99030320-99030342 CTTTTTAAAAAGATGAAACAAGG - Intergenic
994817819 5:104607073-104607095 CTCTTTAAATACATTAAACAAGG - Intergenic
994946060 5:106393231-106393253 CATTTAAAATACATTTAAGTGGG - Intergenic
994952413 5:106481141-106481163 ATTTTCAAGTTCATGTAACTTGG - Intergenic
996837152 5:127806060-127806082 CTTCTTAACCACATCTAACTGGG - Intergenic
997057113 5:130457714-130457736 CTGTTTACATACATATCACTCGG - Intergenic
997059569 5:130485305-130485327 AATTTTAAATACATTTATCTTGG + Intergenic
998949780 5:147381690-147381712 CTTTTTGAATTCATCTTACTTGG + Intronic
999632631 5:153586506-153586528 TTTGTTAAATTCATATAACTTGG - Intronic
1000126841 5:158253793-158253815 TTTCTTAAATACAAGTAACATGG + Intergenic
1000988862 5:167891101-167891123 TTTTTTAAATACATGTGAATAGG - Intronic
1001784029 5:174396389-174396411 CATTTTAAAAACAAGTAAATAGG - Intergenic
1001976913 5:176007616-176007638 TTGTTTAAATAGATGTAATTGGG - Intronic
1002240515 5:177836164-177836186 TTGTTTAAATAGATGTAATTGGG + Intergenic
1002592661 5:180301868-180301890 GCTTTTAAACACAGGTAACTTGG + Intronic
1002948150 6:1782220-1782242 CTTTTTAAATACATGTAACTGGG - Intronic
1003200873 6:3959197-3959219 CTTATTAAAAACTTATAACTCGG + Intergenic
1005723986 6:28630982-28631004 CTTTTAAAATATATGTACCATGG - Intergenic
1006221204 6:32493445-32493467 CTTTTTAAAAACTTTTTACTTGG + Intergenic
1008668769 6:53744653-53744675 CTTGTTAAAGTCAGGTAACTGGG + Intergenic
1009462996 6:63936281-63936303 ATTTTTAAATACATGTAAATTGG - Intronic
1009843159 6:69102501-69102523 CTGTTTAAATACATGGCATTAGG + Intronic
1009893246 6:69714890-69714912 TTTGTTAAATACATATATCTAGG + Intronic
1010510364 6:76710968-76710990 CTTCCTAACTACATGTACCTGGG - Intergenic
1010776860 6:79896798-79896820 CTTGTTAAACACATGTACATTGG - Intergenic
1011543555 6:88459723-88459745 CATTTTAAATAGAAGAAACTGGG - Intergenic
1012199460 6:96387436-96387458 CTTCTCAAATACATATTACTAGG - Intergenic
1012201036 6:96406254-96406276 CCTCTTAAATACATGTAGCTTGG - Intergenic
1012307232 6:97674114-97674136 CATTTTAAATACATATAAATTGG - Intergenic
1013696869 6:112713284-112713306 CTTGTTATATTCATGTAATTAGG - Intergenic
1013804210 6:113979196-113979218 CTTTTGAAATACACATAAATTGG + Intronic
1014302402 6:119698812-119698834 CTTTTTCAATGCATGTAACAAGG - Intergenic
1014575600 6:123067165-123067187 CTTTTTTAATACTGTTAACTAGG + Exonic
1014596089 6:123341260-123341282 CTTTGTAATTAAATATAACTTGG + Intronic
1015051463 6:128845775-128845797 CTTTTTAAATACATGAGATTAGG - Intergenic
1015103922 6:129514244-129514266 CATTTGAAATGGATGTAACTGGG - Intronic
1015609591 6:135001914-135001936 ATTTTTAAAAAAATATAACTTGG + Intronic
1015997558 6:139010134-139010156 GTTTTTCAATACATGTCATTTGG + Intergenic
1016755915 6:147686501-147686523 TCTTTTAAATACATGAGACTAGG - Intronic
1016986984 6:149902916-149902938 CTTTTAAACTACTTGTATCTTGG + Intergenic
1017029344 6:150207161-150207183 CTTTTTAAAAACATCAAAATAGG - Intronic
1018325536 6:162663779-162663801 CTTTTTAGTTTCATGTAACTTGG - Intronic
1018778879 6:167044613-167044635 ATTTTTAAAAACATGTATCAGGG - Exonic
1018999742 6:168739818-168739840 CTTTTCAAGTAGATGTAATTAGG - Intergenic
1020415737 7:7943702-7943724 GTGTTTAAATAAATGTAATTAGG - Intronic
1020944529 7:14585549-14585571 CTTTTAAAATCCATGTCAATGGG + Intronic
1021008456 7:15430670-15430692 CCATTTAAATATATGTAACAAGG - Intronic
1021034255 7:15777724-15777746 CTTTTTAAATAGATTTAATTGGG + Intergenic
1021135395 7:16959131-16959153 CCTTTTCAATACATGGAGCTAGG - Intergenic
1021277308 7:18668446-18668468 CTTTTAAAATACATTTTATTTGG + Intronic
1021316903 7:19158861-19158883 CTTATTTAATGCCTGTAACTTGG - Intergenic
1021330927 7:19338712-19338734 CTTTTTAATAACTTGTAACCTGG + Intergenic
1021337675 7:19423764-19423786 GTTTTTAAAGACATGTTATTTGG + Intergenic
1022054855 7:26719789-26719811 TTTCTTACATACATGAAACTAGG - Intronic
1022302233 7:29112609-29112631 TTTTTTAAAGACCTGTAGCTCGG + Intronic
1023383370 7:39630740-39630762 TTTTTTAAATAAATGTCATTGGG - Intronic
1024895936 7:54262245-54262267 CTTTTTCAATAAATGGAGCTGGG - Intergenic
1025872933 7:65451927-65451949 CTTAGTAAATGCTTGTAACTGGG + Intergenic
1026076229 7:67171975-67171997 CTTTTTAATAACATGTAATTGGG + Intronic
1026082583 7:67235302-67235324 TTTTCTAAATGTATGTAACTGGG + Intronic
1026399337 7:69993448-69993470 GTTTTTGAATATATGTTACTAGG + Intronic
1026694485 7:72578700-72578722 TTTTCTAAATGTATGTAACTGGG - Intronic
1026700628 7:72640315-72640337 CTTTTTAATAACATGTAATTGGG - Intronic
1027972384 7:85101850-85101872 CTTTTTAAATATATCTTATTTGG - Intronic
1028038084 7:86011080-86011102 CTGATTAAATACATGTAGGTTGG + Intergenic
1028514815 7:91665672-91665694 GTTTTTAAATAGATGGTACTGGG + Intergenic
1028525459 7:91780553-91780575 ATGTTTAAATACATTTAAGTTGG + Intronic
1028553084 7:92093331-92093353 CTTATTAAAAACATGTAACAAGG + Intronic
1028864974 7:95698511-95698533 CATTTTCAATACATGGCACTGGG - Intergenic
1028991124 7:97050068-97050090 CTTTTTGATTACTAGTAACTGGG - Intergenic
1029999147 7:105039675-105039697 CTTTTAAACTATGTGTAACTGGG + Intronic
1030329086 7:108253879-108253901 CATTGTAAATAATTGTAACTTGG - Intronic
1030728433 7:112954684-112954706 TTTTTTAAATTCATGTTTCTTGG + Intergenic
1031223792 7:119008333-119008355 CTTTTAGAATATATGTAATTGGG - Intergenic
1032323771 7:130907897-130907919 CCTTTTAAATACATGAATCTTGG - Intergenic
1032975765 7:137220908-137220930 CTTTTCAGATACAGGTAAGTAGG - Intergenic
1033395416 7:140969773-140969795 CTTTTTAAGTTCATGTGACTTGG - Intergenic
1033676789 7:143549070-143549092 CGTTTTAATTATATGTAAATGGG - Intergenic
1033682607 7:143609912-143609934 CTATTTAAATACTTCTTACTGGG - Intergenic
1033695047 7:143780365-143780387 CGTTTTAATTATATGTAAATGGG + Intergenic
1033702286 7:143852005-143852027 CTATTTAAATACTTCTTACTGGG + Exonic
1033898573 7:146106994-146107016 CTTTTTAAATTCATGTACTGTGG - Intergenic
1034052320 7:147996372-147996394 CTTCTTAAAAACAGGTTACTGGG - Intronic
1034747120 7:153532589-153532611 CTTTTTAAAGACATCTTACTGGG + Intergenic
1035795922 8:2356323-2356345 CCTTTTAAATATCTGTAGCTTGG + Intergenic
1037210898 8:16386109-16386131 CTGTTTAAATTACTGTAACTTGG + Intronic
1037280594 8:17237639-17237661 ATACTTAAATACATTTAACTGGG + Intronic
1038279198 8:26148362-26148384 TTTTTTAAATATATGTATATAGG + Intergenic
1038769986 8:30468956-30468978 CCTCTTAAATTCATGGAACTGGG - Intronic
1038825686 8:30998322-30998344 CTTCAGAAAAACATGTAACTAGG + Intronic
1039396508 8:37229849-37229871 ATTTTTAAATAGATGTTATTGGG + Intergenic
1040416684 8:47201987-47202009 CTTGTTAAATACAAATTACTAGG + Intergenic
1040418249 8:47215417-47215439 CCTTTTAAATATATATAGCTTGG + Intergenic
1040672994 8:49715003-49715025 CTTTTTAAAACCAGTTAACTGGG + Intergenic
1041601620 8:59724188-59724210 GCTTTTAAATACATATAAATGGG + Intergenic
1041898622 8:62956382-62956404 CTGTTCACATACATGTACCTGGG - Intronic
1041925812 8:63235015-63235037 CTTTTTAAATTCATGGTGCTGGG + Intergenic
1042222426 8:66486700-66486722 GTTTTTAAATACCTGTGCCTGGG + Intronic
1043314735 8:78906456-78906478 TTTTTTAAAACCCTGTAACTAGG - Intergenic
1043346888 8:79308569-79308591 ATTTTTAAAAAGATGTAATTGGG + Intergenic
1043706399 8:83356513-83356535 CCTCTTAAATACATATAGCTTGG + Intergenic
1044288400 8:90438093-90438115 CTTTTTAAAAATATATAATTTGG + Intergenic
1044653119 8:94519814-94519836 ATATTTAAATTCATGTATCTAGG + Intronic
1045335766 8:101203289-101203311 CTTTTTAAATATATCAAAATTGG + Exonic
1045977190 8:108142823-108142845 ATTCTTAAATACATGAAACTTGG + Intergenic
1046209341 8:111047043-111047065 CCTTTTTAATAAATGTTACTGGG - Intergenic
1046298557 8:112255847-112255869 CTTTTTATATACATGTAAAAGGG - Intronic
1046358544 8:113119408-113119430 CTTTTTAACTACATGAACTTGGG - Intronic
1046716522 8:117573868-117573890 CTTTTTAAATCCATTTGAGTAGG + Intergenic
1047040205 8:120985476-120985498 TTTTCTAAAAACATGTATCTTGG - Intergenic
1047393892 8:124476063-124476085 TTTTTTAAGTAATTGTAACTTGG + Intronic
1047610815 8:126519040-126519062 CTTTTAAAATACTTGCAAGTGGG + Intergenic
1048796821 8:138158208-138158230 CTTTTTAAATAAATGGTGCTGGG + Intronic
1048955419 8:139532028-139532050 TTTTTTAAATACAGTTAAGTAGG - Intergenic
1050234626 9:3564738-3564760 CTTTTAAAAAATATGTAAATAGG + Intergenic
1050623150 9:7475567-7475589 TTTTTTAAAAAAATGTAACTGGG + Intergenic
1050847911 9:10246541-10246563 CTATTTTAAAACATGTATCTTGG - Intronic
1051326346 9:15974621-15974643 CATTTTTAATACATGTATTTTGG + Intronic
1051653096 9:19350002-19350024 TTTTTTAAAATCATGTAACATGG + Intronic
1051654831 9:19369473-19369495 CTTTTTAAATAATTGGGACTGGG + Intronic
1052018670 9:23499542-23499564 TTTTTTAAGCAAATGTAACTGGG + Intergenic
1052031929 9:23638697-23638719 CTGTTTAAATAAAAGCAACTAGG + Intergenic
1052704109 9:31973099-31973121 CCTTTGAAATACAAGTAAGTTGG + Intergenic
1052734611 9:32328297-32328319 CTTTTAAAATTCCTGAAACTGGG + Intergenic
1053114914 9:35491636-35491658 CTTTATAAAGACATGTAAGAGGG - Intronic
1053462956 9:38284764-38284786 CTTTTTAATTGCATCTAATTTGG + Intergenic
1055828245 9:80352586-80352608 CTTTTTAAAAAAATGTCACAAGG + Intergenic
1056966236 9:91164989-91165011 TTTTTTAAATACACAAAACTGGG + Intergenic
1057088323 9:92231865-92231887 CTTTTCAAGTTCATGTGACTTGG + Intronic
1058197366 9:101994716-101994738 CATTTTAAAAACATATAAATGGG - Intergenic
1059120232 9:111635154-111635176 CACTTTAAAAACATGTAAGTGGG - Intronic
1059140631 9:111849579-111849601 CTTTTTGAATACAGGTTTCTGGG + Intergenic
1059252320 9:112896379-112896401 CTTTTTAAACTCATCTAAGTGGG + Intergenic
1060577001 9:124705034-124705056 ATTTTAAAATACTTTTAACTAGG - Intronic
1186616118 X:11189815-11189837 CTGTTTGTATACATGTACCTTGG + Intronic
1186658079 X:11637787-11637809 CTTCTTAATTACAAGTAATTAGG + Intronic
1187943097 X:24400656-24400678 CTTATGAAATACATGCAATTGGG - Intergenic
1190204013 X:48387681-48387703 CATATAAAAGACATGTAACTTGG + Intronic
1190206523 X:48407722-48407744 CATATAAAAGACATGTAACTTGG - Intronic
1190257084 X:48771615-48771637 CTTTTTATATAAATGTATTTAGG - Intronic
1190633877 X:52415617-52415639 ATTTTGAAATACATGTAAAATGG - Intergenic
1190639817 X:52473452-52473474 TTTTTAAAATTCATGTAAATTGG - Intergenic
1192570275 X:72198057-72198079 CTTTTTAAATAAATGTTTATTGG + Exonic
1193747761 X:85303072-85303094 CTTTTTAAATTCACTTAAATGGG - Intronic
1194009808 X:88547663-88547685 AATTTTAAATAAATGTATCTGGG - Intergenic
1194871572 X:99139139-99139161 ATTTTTAAATACATAAAAATGGG - Intergenic
1195154295 X:102107738-102107760 CGTATTAAATACAAGTAAATGGG - Intergenic
1195255734 X:103088256-103088278 CTTTTTAAATACTTTTTTCTAGG - Intronic
1195550604 X:106165356-106165378 CTTTTTACAGAAATGTAAATTGG - Intergenic
1196007556 X:110852199-110852221 CTTTTGAATTACATGTGAGTGGG + Intergenic
1196539419 X:116887674-116887696 CTTTTTTAAGTCAGGTAACTTGG + Intergenic
1197618097 X:128716716-128716738 TTTTTTAAATTTATGTAACAAGG - Intergenic
1199134646 X:144235696-144235718 CTATATAAATACATGAGACTGGG - Intergenic
1199571037 X:149267573-149267595 ATTTTTAATTACAACTAACTGGG - Intergenic
1199585397 X:149411045-149411067 CTTTATGAATATATGTAAATAGG + Intergenic
1199667946 X:150116745-150116767 TTTTTTAAAAATATGTAACTGGG + Intergenic
1199944363 X:152653535-152653557 CTTTTCAAAGACTTGTAACAAGG + Exonic
1200404972 Y:2800748-2800770 GTTTTTAAAAACATGTGTCTGGG + Intergenic
1200462647 Y:3476594-3476616 CTTATTAAATAAATGGAACAGGG - Intergenic
1202018512 Y:20437324-20437346 CTTTTTAAAATTATTTAACTGGG - Intergenic