ID: 1002948698

View in Genome Browser
Species Human (GRCh38)
Location 6:1787244-1787266
Sequence GTCTCGCTCATTTTTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002948698_1002948699 -4 Left 1002948698 6:1787244-1787266 CCAGTCAGAAAAATGAGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1002948699 6:1787263-1787285 AGACATAAAACAAAGTATAAAGG 0: 1
1: 0
2: 3
3: 88
4: 794
1002948698_1002948700 6 Left 1002948698 6:1787244-1787266 CCAGTCAGAAAAATGAGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1002948700 6:1787273-1787295 CAAAGTATAAAGGACCAGCTAGG 0: 1
1: 0
2: 0
3: 8
4: 157
1002948698_1002948703 22 Left 1002948698 6:1787244-1787266 CCAGTCAGAAAAATGAGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1002948703 6:1787289-1787311 AGCTAGGATTGGAAAAATTCAGG 0: 1
1: 0
2: 1
3: 14
4: 156
1002948698_1002948701 11 Left 1002948698 6:1787244-1787266 CCAGTCAGAAAAATGAGCGAGAC 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1002948701 6:1787278-1787300 TATAAAGGACCAGCTAGGATTGG 0: 1
1: 0
2: 1
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002948698 Original CRISPR GTCTCGCTCATTTTTCTGAC TGG (reversed) Intronic
902300336 1:15497611-15497633 GTCTCGCTCTGTTGTCAGACTGG - Intronic
902364774 1:15965285-15965307 GTCTTGCTCATTTTTCTATTGGG - Intronic
905575851 1:39044052-39044074 GTCTCGCTCATTGCCCAGACTGG - Intergenic
911313613 1:96328600-96328622 GTCTGGCTTATTTTTGTGTCTGG - Intergenic
912845968 1:113074877-113074899 GTCTCGCTCTGTTTTCAGGCTGG - Intronic
913280862 1:117183842-117183864 ATCTCCCTCATTTTTCTTGCTGG - Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915240098 1:154515167-154515189 CTCTGGCTAATTTTTATGACAGG + Intronic
916783418 1:168061068-168061090 GGATCTCTCATTTTTCTGAATGG - Intronic
917475028 1:175362079-175362101 GTGTAGCTCATGTCTCTGACAGG - Intronic
918161838 1:181908455-181908477 GTAATGCTCATATTTCTGACAGG + Intergenic
922467037 1:225851397-225851419 GTCTCGCTCATTGGTCAGGCTGG + Intronic
922987848 1:229880287-229880309 GTCTTGCTCTTTTTCCTGTCTGG + Intergenic
1064073389 10:12249097-12249119 GTCTCGCTCTGTTCTCAGACTGG - Intronic
1067844084 10:49705082-49705104 GTCTCTCTCATTCTTTTGACTGG - Intronic
1069189130 10:65465790-65465812 GCCTCTCTCATTTATGTGACTGG + Intergenic
1070973757 10:80588742-80588764 CTCTCGCTCCTCTTTCTCACTGG - Exonic
1073534650 10:104265742-104265764 GTCTTGCTCATTTTTCCAATGGG + Intronic
1073755542 10:106576955-106576977 TTCTCTCTCTTTTTTCTGATCGG - Exonic
1083420461 11:62549625-62549647 GTCTCGCTCTGTTGTCAGACTGG - Intronic
1087149067 11:94842307-94842329 GTCTGTCTCATTTTTCCTACTGG - Intronic
1087591104 11:100188892-100188914 ATCTCGTTCATTTTTATGGCTGG - Intronic
1088285590 11:108184174-108184196 GTCTTGCTCATTTTATTGGCCGG + Intronic
1088602939 11:111499257-111499279 GTCTCGCCCACTTTTCTTAGGGG - Intronic
1088916359 11:114230877-114230899 GTCTCTCTCTCTTTTCTGTCTGG + Intronic
1094745751 12:33342320-33342342 GTATCCCTCATTTTTCTAATAGG - Intergenic
1098027193 12:66216158-66216180 GACTCCTTCATTTTTCAGACTGG + Intronic
1101729032 12:107411541-107411563 GTCCCCCTCTTTTTTCTGGCAGG + Intronic
1104752219 12:131246948-131246970 GTCTGGGTCTTCTTTCTGACAGG - Intergenic
1105924237 13:24992516-24992538 CTCCCGCTCTTTTTTGTGACAGG + Intergenic
1106017104 13:25879975-25879997 GTCTGCCTTATTTTTCTCACGGG - Intronic
1109921822 13:69073875-69073897 GTCTGATACATTTTTCTGACGGG + Intergenic
1110599070 13:77350867-77350889 GGTTCACTCATTTTTCTGAGGGG + Intergenic
1111695016 13:91612662-91612684 GTCTCCCTAATTTTACTGACAGG - Intronic
1111861587 13:93714253-93714275 GTTTTGCTCATTTTTCTAATGGG - Intronic
1114053473 14:18943722-18943744 GTCTCCCTTCTTTTTCTGTCTGG + Intergenic
1114055038 14:18960647-18960669 GTCTCCCTCCTTTTTCTGTCTGG + Intergenic
1114107503 14:19441131-19441153 GTCTCCCTCCTTTTTCTGTCTGG - Intergenic
1114109086 14:19458203-19458225 GTCTCCCTTCTTTTTCTGTCTGG - Intergenic
1121662172 14:95643454-95643476 TTCTCTCTCCTTTCTCTGACTGG + Intergenic
1123955623 15:25331366-25331388 GTCTCGCTCATTGCCCTGGCTGG - Intergenic
1124423466 15:29542036-29542058 GTCTCGCTCTTTTGCCAGACTGG + Intronic
1125453204 15:39830474-39830496 GTCTCTCTCTTTTGTCTGCCTGG - Intronic
1129369562 15:75081525-75081547 GTCTCGCTCTTTTGTCAGGCTGG - Intronic
1130433736 15:83875107-83875129 CTCTCCCTCTTTTTTCTCACAGG - Intronic
1134306633 16:13038936-13038958 GTCTCACTCTGTTTTCAGACTGG + Intronic
1135916317 16:26608492-26608514 GTCTCCCTCAGTTTCCTGCCTGG + Intergenic
1136015110 16:27392586-27392608 GTCTCGCTCTGTTGTCTCACAGG - Intergenic
1138190919 16:55013446-55013468 TTCTCTCTCATTTTCCTGCCAGG + Intergenic
1138409234 16:56825008-56825030 TTCTGACTCATTTTGCTGACTGG - Intronic
1138885089 16:61066948-61066970 GCCTTCCTCATTTTCCTGACAGG - Intergenic
1140425772 16:74859982-74860004 GTCTGGCAGATTTTTCTGAAGGG + Intergenic
1143067531 17:4262156-4262178 GTCTCTCTCTTTTTTAAGACAGG + Intronic
1143103665 17:4517684-4517706 TTCTCCCTCATTTTTTTGAGAGG + Intronic
1143623205 17:8092993-8093015 GTCCCACTCATGTATCTGACAGG + Intergenic
1146511962 17:33457543-33457565 GTCTTGTTCATTTTTATGCCTGG - Intronic
1146564088 17:33896940-33896962 GTCTGGTTCATTTTTCGGCCAGG - Intronic
1147616281 17:41830204-41830226 GTCTAGCTCATTTTTCACAATGG - Intronic
1149060992 17:52421625-52421647 TTCTCACTCATTTTTTTCACTGG - Intergenic
1149599162 17:57882099-57882121 GTCTAGGCCATTTATCTGACAGG + Intronic
1151527704 17:74682334-74682356 CTCTCTCTCATTTTTCTCTCTGG + Intronic
1155203940 18:23541194-23541216 GTCTAGCCGATTTTTCTGAGGGG + Exonic
1155576247 18:27250486-27250508 GTCTCACTCAGTGTTCTGATGGG + Intergenic
1156444277 18:37223288-37223310 GTCTCCCTACTTTTTCTCACTGG + Exonic
1157153329 18:45241062-45241084 GTCTCACTCATTATTCTTCCTGG - Intronic
1162911628 19:13850824-13850846 GTGTCGCTTCTTTTACTGACGGG - Intergenic
1162932639 19:13964893-13964915 GTCTCGCTGTTTCTTCTGAAGGG + Intronic
1164381318 19:27739071-27739093 GTCTCTATCATTATTCTGTCTGG + Intergenic
1165556236 19:36635047-36635069 GTCTCGCTCTGTTGTCAGACTGG + Intergenic
1166551117 19:43666880-43666902 CTTTCGTTCATTTTTTTGACAGG + Intronic
1168420222 19:56197080-56197102 GTCTCGCTCATTTCCCAGGCTGG - Intronic
926940003 2:18125649-18125671 GTCTCTCTCATTTATCTTAAGGG - Intronic
931090789 2:58883781-58883803 CTCTCTCTCATTTCTCTGTCAGG - Intergenic
931657917 2:64526877-64526899 GTATCCCTCATTTTTCAGAGAGG + Intronic
931764457 2:65442478-65442500 GTCTCGCTCAGTTTCCAGGCTGG - Intergenic
937955107 2:127417720-127417742 ATCCCGTTCATTTTTCTTACTGG + Intergenic
938471438 2:131566221-131566243 GTCTCCCTTTTTTTTCTGTCTGG + Intergenic
938473049 2:131583434-131583456 GTCTCCCTCCTTTTTCTGTCTGG + Intergenic
941432795 2:165432145-165432167 TTCTCTCTCCTTTTTCTGATAGG + Intergenic
942574507 2:177349197-177349219 GTCACCCTCATTTTTTTGCCTGG - Intronic
943236175 2:185322686-185322708 TTCTTGTTCACTTTTCTGACTGG - Intergenic
943654190 2:190489971-190489993 GTTTGGCTCAATTTTCTGAGTGG + Intronic
944194844 2:197041498-197041520 CACTTGCTCATTTTTCTCACTGG + Intronic
944780987 2:203015882-203015904 GTCTTGCTCCTTATTCTCACTGG + Intronic
946839591 2:223807259-223807281 GTCTCTCTCTTTTTTGAGACAGG - Intronic
1168997927 20:2146536-2146558 GTCCTGCTGATTCTTCTGACGGG - Exonic
1170799179 20:19576415-19576437 GTCTCTCTCATGTTACTCACTGG - Intronic
1177012372 21:15744483-15744505 GCCTGGCTAATTTTTATGACGGG + Intronic
1180471942 22:15666103-15666125 GTCTCCCTTCTTTTTCTGTCTGG + Intergenic
1180473519 22:15683197-15683219 GTCTCCCTCCTTTTTCTGTCTGG + Intergenic
1180753199 22:18140271-18140293 GTCTCGCTCTTTTGTCAGGCTGG - Intronic
1183975173 22:41507850-41507872 GCCTCGCTCAATTTCCTGGCTGG - Exonic
949716577 3:6938765-6938787 GTCTCCTTCATTTTTTTGTCAGG - Intronic
953520239 3:43635647-43635669 GTCTCGCTCTTTTACCAGACTGG + Intronic
962476982 3:135763473-135763495 GCCTCCCACAGTTTTCTGACGGG - Intergenic
962895755 3:139713265-139713287 GTCTCGCTCATATCTCTAGCTGG - Intergenic
965472444 3:169111147-169111169 GACTCTCTCATTTTTCAAACAGG + Intronic
965494581 3:169382270-169382292 ATCTCCCTCATTTCTCTGTCTGG - Intronic
967093936 3:186161371-186161393 GTCTCATTCAATTTTGTGACCGG + Intronic
967538228 3:190632422-190632444 GTTTAGCTCATTTTTGTTACTGG + Intronic
969513690 4:7634341-7634363 GTCTCGCTCTGTTTTCAGGCTGG - Intronic
970832166 4:20352881-20352903 GTCTCACTCAGTTTTCAGGCTGG - Intronic
976006538 4:80437026-80437048 GTATCCCTCATTTTTCTGCTGGG + Intronic
978709476 4:111761324-111761346 GTCTGACTCATTTTTCTTATTGG - Intergenic
978801285 4:112757907-112757929 GTCTCGCTCGTTTCTCAGGCTGG + Intergenic
980406490 4:132359198-132359220 GTCTTGGTGATTTTTCTGATAGG - Intergenic
982252072 4:153417256-153417278 GTTTCGCTCTTGTTGCTGACTGG - Intergenic
982373814 4:154664740-154664762 GTCTCGCTCTTTTGCCAGACTGG + Intronic
986022475 5:3817799-3817821 GTCTCGCTCTTTTTCCAGACTGG + Intergenic
986734623 5:10659954-10659976 GTCTCCTTCATCTTCCTGACTGG + Intergenic
1000482119 5:161790583-161790605 GTCTGGCTCATTCTCATGACTGG - Intergenic
1002948698 6:1787244-1787266 GTCTCGCTCATTTTTCTGACTGG - Intronic
1017649923 6:156571341-156571363 CTTTCTCTCATTTTTCTGAGAGG + Intergenic
1018924727 6:168198270-168198292 GTCTTGCCCATTTTTCAGATGGG + Intergenic
1024178191 7:46862074-46862096 GTCTCTCTCATCTTTCTCAGGGG - Intergenic
1024982436 7:55168893-55168915 GTCTCTCTCATTTCTCAGATGGG + Intronic
1025735947 7:64146918-64146940 GTCCAGCTCATTTTTGTGATGGG + Intronic
1028096587 7:86768656-86768678 GTCTCCCACAGTTTTCTGATTGG - Intronic
1028766222 7:94562968-94562990 GTGTCTCTTATTTTTCTGAAGGG - Intergenic
1030689504 7:112517868-112517890 GTCTCCCTCATTTTTCTACACGG - Intergenic
1030845043 7:114399429-114399451 GTTTTTCTTATTTTTCTGACTGG + Intronic
1030882495 7:114898542-114898564 TTCTCTCTCTTTTTTCTAACAGG - Intergenic
1034430774 7:151040246-151040268 CCCTCTCTCCTTTTTCTGACAGG + Exonic
1038707378 8:29907408-29907430 GTCTCTCTCTTTATTCTGTCTGG + Intergenic
1040617417 8:49051269-49051291 GTCTTGCTCCTGTTTCTGAAAGG + Intergenic
1050867025 9:10513862-10513884 ATCTTGCTCATTTTTCAGTCAGG - Intronic
1051408964 9:16769394-16769416 TTCTCTCCCATTTTACTGACAGG + Intronic
1057381777 9:94574473-94574495 GTCTTGCTTATTTTTCTATCAGG + Intronic
1057827443 9:98381839-98381861 GTCACGCTCATTTGTGTGAGGGG - Intronic
1058636703 9:107044976-107044998 GTCTCCCTTACTTTTCTGATTGG - Intergenic
1059426089 9:114221885-114221907 TTCACGCTCATTTTACAGACAGG - Intronic
1186895864 X:14004237-14004259 GTCTAGCTCATTTCTCTTAAGGG + Intergenic
1187090594 X:16092101-16092123 CTCTCTATCACTTTTCTGACAGG - Intergenic
1187173362 X:16871564-16871586 GTCATGCCCACTTTTCTGACCGG + Intergenic
1187508492 X:19896661-19896683 GTCTCGCTCTTTTGCCTGGCTGG - Intergenic
1188459189 X:30403748-30403770 CACTCACTCATTTTTCTGTCTGG + Intergenic
1196344862 X:114642593-114642615 GTCTCACTTATTAATCTGACTGG - Intronic
1197991375 X:132321626-132321648 TTCTCGCTCCTTTATCTGGCTGG + Intergenic
1199006393 X:142702921-142702943 GTATCACTCATCTTTATGACAGG + Intergenic
1200852106 Y:7893890-7893912 GTCCCACTCACTTTGCTGACAGG + Intergenic