ID: 1002950978

View in Genome Browser
Species Human (GRCh38)
Location 6:1810648-1810670
Sequence CAGGGAACAGACAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1087
Summary {0: 1, 1: 1, 2: 10, 3: 117, 4: 958}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002950978 Original CRISPR CAGGGAACAGACAGGGAGGA GGG Intronic
900317716 1:2067694-2067716 CAGTGAACGGACAGTGAAGATGG - Intronic
900566549 1:3335032-3335054 AAGGGCACAGCCAGAGAGGACGG + Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901175909 1:7298900-7298922 AAGGGAAGAGAGAGGAAGGAAGG - Intronic
901478536 1:9507537-9507559 AAGGGAACAGGCAGGCCGGACGG - Intergenic
901513300 1:9729171-9729193 CAGGGACGGGACATGGAGGATGG + Exonic
901544732 1:9947406-9947428 CATGGAGCAGTGAGGGAGGAAGG - Intronic
901727109 1:11250519-11250541 GAAGGAACAGCCAGGGAGGGAGG - Intronic
901770228 1:11526443-11526465 CAAGGCTCAGAGAGGGAGGAAGG + Intronic
902145232 1:14393038-14393060 CAGAGAACAGTCCGGAAGGAGGG - Intergenic
902395163 1:16128537-16128559 GCGGGAACAGACCGGGAGGCTGG - Intronic
902490897 1:16779623-16779645 GATGCAACAGACAGGGAGGAGGG + Intronic
902894461 1:19469203-19469225 GAGGGAACAGGCAGGGAAGGGGG + Intronic
903538058 1:24080425-24080447 CAGGGAAGCTACCGGGAGGAGGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903606901 1:24581488-24581510 CAGGGAACTTACAGGTAAGAAGG - Intronic
903651400 1:24924577-24924599 GAGGGAACAGGCAGGGTGGCAGG - Intronic
903671567 1:25038992-25039014 CAGGGAAGAGGCAGGGCAGATGG + Intergenic
903806160 1:26007038-26007060 CAGGAAGCAGACAGGGAGAAGGG - Intergenic
904001757 1:27342801-27342823 CAGGGCACAGAGAGGGACGTGGG + Intronic
904337959 1:29810283-29810305 CTGGGACCAGAGAGGGAGGGAGG - Intergenic
904483763 1:30810530-30810552 GGGGGAACTGACAAGGAGGAAGG - Intergenic
905106093 1:35564456-35564478 CAGGGAACAGGCAGGGACAGAGG - Intronic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
906110259 1:43317792-43317814 ATGGTAACAGACAGGGATGAAGG - Intronic
906161328 1:43650938-43650960 CAGGGAACAGATTTGGGGGAAGG + Intronic
906190236 1:43894237-43894259 CAGTGAACAGGCTGGGTGGAGGG + Intronic
906588364 1:47000855-47000877 CAGGGAACAGAAAGAAAGGATGG + Intergenic
906638677 1:47427715-47427737 CAGGGAGAAGACAGAGAGTAGGG + Intergenic
906701157 1:47859209-47859231 CAGGAAAAAGAAAGGAAGGATGG - Intronic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
909417674 1:75425886-75425908 AAGGGCACTGAAAGGGAGGAAGG - Intronic
909469299 1:76008822-76008844 GTGGGAAGAGAGAGGGAGGAAGG - Intergenic
909480545 1:76125269-76125291 CAGGGAACAGGTAAGGAGGAGGG - Intronic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
912680066 1:111723390-111723412 TTGGGAAGAGAAAGGGAGGAGGG + Exonic
913156133 1:116100459-116100481 CAGGGAGGAGGCAGGAAGGATGG - Intergenic
913372345 1:118114994-118115016 CAAGGAAGAGACAGGGAGTCGGG - Intronic
914334750 1:146704252-146704274 GAGGGAAGAGACAGGGAGAGAGG + Intergenic
914388804 1:147199187-147199209 TAGGGAACAGACAAGGAAGGAGG + Intronic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915346108 1:155197791-155197813 GAGGAAACAGACAGGGAGAATGG - Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
918018289 1:180659490-180659512 TGGGCAACAGAGAGGGAGGAAGG - Intronic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
919342147 1:196325276-196325298 CAGGTTACAGACAGGAAGGTAGG - Intronic
919896248 1:202011370-202011392 GGGGGAATAGGCAGGGAGGAGGG + Intronic
919933605 1:202237091-202237113 CAGGGACCAGACACAGAGGCAGG - Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
919988412 1:202691830-202691852 CAGGAAACCTGCAGGGAGGAGGG - Intronic
920116364 1:203624502-203624524 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
920441646 1:205984880-205984902 CTGGGAGGAGGCAGGGAGGAGGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920915899 1:210257764-210257786 CAGGGAAAATACTGGCAGGAAGG + Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
920985427 1:210884643-210884665 GAGTGAACAGGCAAGGAGGATGG - Intronic
921361647 1:214335249-214335271 CAGGGCACAGCCAGGCTGGAAGG + Intronic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921669773 1:217912746-217912768 CAGGAGAGAGACAGAGAGGAGGG - Intergenic
922464608 1:225838622-225838644 CAGAGCACAGTCAGGGTGGAGGG - Intronic
922575388 1:226657951-226657973 CTGGGAACAGACTTGGAGGGAGG - Intronic
922909274 1:229202120-229202142 CAGGAAACAGACACTCAGGATGG + Intergenic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
923094227 1:230761832-230761854 CTGGGAACAGGAAGGGAGGTTGG - Intronic
923249675 1:232168169-232168191 CAGGGAAAAGGCAGGCATGAGGG - Intergenic
923321846 1:232842119-232842141 TAGTGAAAAGACAGGGAGGCTGG - Intergenic
923425511 1:233864954-233864976 AAGGGAAGAGACAGGGAGTGGGG + Intergenic
923467813 1:234264930-234264952 GAAGGAACAGCCAGAGAGGAAGG - Intronic
923518897 1:234720909-234720931 CAGGGAAGAGCCAGGAAGGGAGG + Intergenic
923529548 1:234802913-234802935 GATGCAACTGACAGGGAGGAGGG - Intergenic
923787990 1:237086530-237086552 AAGGTAACAGACTGGGAAGAAGG - Intronic
924668655 1:246100520-246100542 CAGCAAGCAGTCAGGGAGGAGGG - Intronic
924712477 1:246541344-246541366 CAGGGAAGAGGATGGGAGGAGGG + Intronic
1062875395 10:939275-939297 GAGGGAGCAGCCAGGGATGAAGG + Intergenic
1063163389 10:3437507-3437529 CAGGGAAGAAACAGGGAGATGGG - Intergenic
1063539493 10:6918012-6918034 GAGGGAATAGACGGGCAGGAAGG + Intergenic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064165304 10:12980522-12980544 CACAGGGCAGACAGGGAGGAGGG + Intronic
1064264743 10:13816771-13816793 CAGGGATCGGACTGGGAGCAAGG + Intronic
1065276558 10:24092089-24092111 GAGGAAGCAGACAGAGAGGATGG - Intronic
1065363179 10:24908702-24908724 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1065644065 10:27816188-27816210 CAGGGACAAGACAGGGTGCAGGG - Intronic
1065726149 10:28669394-28669416 CAGCGAAGAGAGTGGGAGGAGGG - Intergenic
1065813096 10:29460430-29460452 TAGTGAATACACAGGGAGGATGG + Intronic
1066068336 10:31778705-31778727 CTGGGAGGAAACAGGGAGGATGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066444504 10:35469682-35469704 CAGGGAGAAGACAGGGAGATAGG + Intronic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1066784423 10:38987439-38987461 CAGGGGAAAGGCTGGGAGGAGGG - Intergenic
1067101826 10:43339593-43339615 CTGGGAACAGACACTCAGGACGG + Intergenic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1067750172 10:48966494-48966516 CAGGGAACAGACACACATGAGGG - Intronic
1067765391 10:49082012-49082034 CAGAGAACAGCCAGGGAGGGGGG - Intronic
1068208839 10:53893790-53893812 CGGGGGACAGAGTGGGAGGAAGG + Intronic
1068830720 10:61491584-61491606 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1069250943 10:66266064-66266086 AAGGGAAAAGAGAGAGAGGAAGG + Intronic
1069360308 10:67633862-67633884 CCTGAAAGAGACAGGGAGGATGG + Intronic
1069608033 10:69752553-69752575 CAGGAGAGAGTCAGGGAGGATGG + Intergenic
1069629871 10:69890981-69891003 AGGGAAACAGAAAGGGAGGAAGG - Intronic
1069861641 10:71475382-71475404 CAGGAAACAGAAAGGGAAGCAGG - Intronic
1070732695 10:78842257-78842279 CAGCCAACAGGCAGGGAGGGAGG + Intergenic
1070743748 10:78920041-78920063 CTGGGAAGAGGCAGGGAGGGAGG + Intergenic
1070930430 10:80256973-80256995 CAGGGACCAGGCAGCGAGGGAGG - Intergenic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071301723 10:84261236-84261258 CAGAGGAGAGGCAGGGAGGAAGG + Intergenic
1071302641 10:84267951-84267973 TAGGGAACAGATAGGGAAGCTGG + Intergenic
1071848041 10:89540021-89540043 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072272565 10:93791130-93791152 GAGGTAATAGACATGGAGGAGGG - Intronic
1072543267 10:96414451-96414473 CAGGGAGAAGACAGTGAGGAGGG - Intronic
1072555203 10:96509536-96509558 GAGGAATGAGACAGGGAGGAAGG - Intronic
1072723972 10:97800305-97800327 CAGTGGTCAGACAGGGAGAAAGG + Intergenic
1072805163 10:98419384-98419406 AAGGGAAAAGACAGAGAGGAGGG + Intronic
1072899541 10:99394867-99394889 GAGGGAACAGCCAGGCAGGTGGG + Intergenic
1075050295 10:119178542-119178564 CGGGGAAGAGACCGCGAGGATGG + Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075103035 10:119519317-119519339 CTGGGGACAGACAGGGAGACAGG - Intronic
1075222984 10:120600689-120600711 CAGGAAACAGAGAGGATGGAAGG + Intergenic
1075299334 10:121307412-121307434 CAGGGAGCAGAAGGGAAGGATGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075546188 10:123356621-123356643 CCGGTGACAGAGAGGGAGGATGG + Intergenic
1075607631 10:123825231-123825253 TAGAGAAGAGACAGAGAGGAAGG + Intronic
1075845748 10:125544048-125544070 CAGGGAAGAAACAGGGCAGAGGG - Intergenic
1076106247 10:127825945-127825967 CCGAGAAGAGCCAGGGAGGAAGG + Intergenic
1076181509 10:128412587-128412609 CAGGGAAAAGCCAGGGAGGGTGG - Intergenic
1076349770 10:129807998-129808020 CAGGGAGGAGAAAGGGAGGCAGG - Intergenic
1076372600 10:129964816-129964838 CGGGCAACGGACTGGGAGGAGGG + Intergenic
1077307084 11:1873264-1873286 CAGGGTCCTGGCAGGGAGGAAGG - Intronic
1077358952 11:2131266-2131288 CAGGGCACAGACAGGGCCGAGGG + Intronic
1077467363 11:2739796-2739818 CAGGGGACAGAGAGAGGGGAGGG + Intronic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078390464 11:10931725-10931747 CGGGGAGCAGAAAGGAAGGAGGG + Intergenic
1078421198 11:11214440-11214462 CAGGGGACAGAAAGCAAGGAAGG + Intergenic
1078454943 11:11467610-11467632 CAGGGCACAGACAGGCACCATGG + Intronic
1078511095 11:11984828-11984850 CAGGGAAGAGACTGGAAGGCAGG - Intronic
1078764077 11:14276632-14276654 AAGGGAACAAGCAGGGAGGGAGG + Intergenic
1079012683 11:16842341-16842363 CATGGAGCAGTGAGGGAGGAAGG - Intronic
1079112264 11:17611468-17611490 CAGGGAAGAGGAAGGGATGAAGG - Intronic
1079390770 11:20020054-20020076 CAGGGAAAAGCCAGGAAAGAGGG + Intronic
1080084477 11:28261409-28261431 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1080262513 11:30364840-30364862 CTGGGAATAGACAGGGAGGCTGG - Intergenic
1080559830 11:33452778-33452800 CAGGGGACACACAGGGGCGAGGG - Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1081207660 11:40293558-40293580 GAGGGGACAGACAGGGTGGTAGG + Exonic
1081602740 11:44506475-44506497 CAGGGAAGAGGCAGGGTGGATGG + Intergenic
1081946835 11:47003357-47003379 GAGGGGACAGAGAGGAAGGAAGG + Intronic
1082745269 11:56954305-56954327 TAGGGGACAGAAAGGGAAGAGGG + Intergenic
1082759659 11:57115089-57115111 CAGGGAAGAGGCAGGTAGAAGGG + Intergenic
1082811739 11:57482720-57482742 CTGGGAAAAGACGGGGAGGGGGG + Intergenic
1083138694 11:60703846-60703868 TAGGGCACAGGCATGGAGGAAGG - Intronic
1083303336 11:61750098-61750120 CTGAGAACTGACAGGGAGGCTGG + Intergenic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083627951 11:64081589-64081611 CAGGCCAAAGACAGGGAGCAAGG + Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083687358 11:64384607-64384629 CAGGGAGCAGGCAGGAGGGAGGG - Intergenic
1083722140 11:64608701-64608723 CAGGGAGCAGAGAGTGAGGGAGG - Intronic
1083726547 11:64631329-64631351 CAGAGGACAGACAGGGACGGAGG + Intronic
1083890806 11:65595014-65595036 GAGGGCACAGACAGGGATGAGGG - Intronic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1083949854 11:65947880-65947902 CAGGGAGCAGTCAGGGAGGCAGG + Intronic
1084133886 11:67160078-67160100 CAGGGAAGAGGCAGTGAGGCAGG - Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084386199 11:68844006-68844028 CTGGGAACAGACAGGGCGCGGGG - Intronic
1084416231 11:69034315-69034337 GTGGGTACAGACAGGGAGGCAGG - Intergenic
1084581775 11:70028659-70028681 CAAGACCCAGACAGGGAGGAAGG - Intergenic
1084662993 11:70558077-70558099 CACGGAACAGCCAGAGAGCATGG - Intronic
1084968637 11:72757484-72757506 GAGGGAACAGCCAGTGAGCAGGG + Intronic
1084972687 11:72780453-72780475 AAGGGAGCAGCCAGGGAGGGAGG + Intronic
1085025612 11:73234794-73234816 CACGTAACAGACAAGGATGACGG - Exonic
1085391697 11:76185470-76185492 GAAGGAACAGCCAGGGAGGCAGG - Intergenic
1085482340 11:76833119-76833141 GAGGGACAAGACAGAGAGGAGGG - Intergenic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1085801433 11:79593644-79593666 CAGGGAAGGGTCAAGGAGGAAGG - Intergenic
1085806692 11:79643157-79643179 TAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1086218526 11:84412670-84412692 CTGGGAACAGCCAGTAAGGAAGG - Intronic
1086590111 11:88505555-88505577 TGGGGAACAGAAAGGGAGTATGG - Intronic
1086719323 11:90100882-90100904 CAGGGGACAGAAAGGAAGGATGG + Intergenic
1086951663 11:92897046-92897068 GAGGTTACAGACAGGGAGTAGGG + Intergenic
1087652546 11:100884923-100884945 GAGGGAGCAGGCAGGGAGAATGG - Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087961962 11:104363061-104363083 CAGGGAACAAAAAGGGCTGATGG - Intergenic
1088551631 11:111019364-111019386 CAGGTCAAAGACAGTGAGGAAGG - Intergenic
1088575182 11:111264750-111264772 GAGGGAAGAGACAGGAAGGAAGG + Intronic
1088606642 11:111540070-111540092 CAGGGAACAGGTTGGGAGGTGGG - Intergenic
1089303809 11:117514447-117514469 CAGGGAAAGGACAGGCTGGAGGG - Intronic
1089333707 11:117708082-117708104 TAGGGCACAGAGAGGGAGGCAGG - Intronic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1089754576 11:120677136-120677158 CAGGGAAGAGACAGCTGGGAAGG + Intronic
1089959239 11:122601003-122601025 AAGGAAAGAGGCAGGGAGGAAGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090083496 11:123630566-123630588 ATGGGAAGAGACAGGGAGGTGGG + Exonic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090440448 11:126720925-126720947 CAGGGAACAATCTGGGAGAAAGG + Intronic
1090471469 11:126984848-126984870 CAGGGAGGAGACCTGGAGGAGGG + Intronic
1090534018 11:127620656-127620678 GAGGGGAGAGACAGGGAGGGGGG + Intergenic
1091386062 12:95570-95592 CAGGGAAAAAACATGGAGGTAGG - Intronic
1091626732 12:2126880-2126902 CAGGGACCAGGCAGAGGGGAGGG - Intronic
1091752807 12:3033177-3033199 CAGGGGACAGGCAGGGAGGCTGG - Intronic
1091818750 12:3458836-3458858 AGGTGAACAGACAGGAAGGAGGG - Intronic
1091825865 12:3512242-3512264 GAGAGAACAGTCAGGGAGGTGGG - Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092240607 12:6833898-6833920 CAGGGAAAAGACAGAGCAGAGGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092566605 12:9672670-9672692 CCTGAAAGAGACAGGGAGGATGG - Intronic
1092602758 12:10084274-10084296 CATGGAACAGTGAGGGAGGAAGG - Intronic
1092663019 12:10759481-10759503 GAGGGAACAGAAAGGGAGGTGGG + Intergenic
1092692684 12:11131186-11131208 CATGGAAGAGAGAGAGAGGAGGG - Intronic
1092942306 12:13421266-13421288 CAGGGAACATATAGTGAGAAAGG - Intergenic
1093055712 12:14553860-14553882 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1093209373 12:16289340-16289362 AAGGGAACAGACCAGGAGAAAGG + Intergenic
1093926072 12:24909679-24909701 CAGGAAGCAGACAGACAGGAAGG - Intronic
1094154263 12:27321028-27321050 GAGGGAACAGTCATGGAGCAGGG + Intronic
1094202285 12:27806280-27806302 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1094214288 12:27923899-27923921 CAGGGAACAGATGGGTTGGATGG + Intergenic
1094240533 12:28218062-28218084 AAGGGATCAAACACGGAGGATGG - Intronic
1095933712 12:47654618-47654640 TGGGGAACAGACAGGGAAGGTGG - Intergenic
1096321814 12:50620843-50620865 GAGGGAACTGATTGGGAGGAGGG - Intronic
1096531957 12:52248147-52248169 CAGAGGACAGACAGTGAGGACGG - Intronic
1096620430 12:52861210-52861232 CTGGGCACAGCCAGGCAGGAGGG + Intergenic
1097262472 12:57727329-57727351 GAGGGAACAGAGCGGGGGGAGGG - Intronic
1097297089 12:57978164-57978186 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097492575 12:60289581-60289603 CAGGTAAGAGATAGTGAGGAAGG - Intergenic
1098344228 12:69484561-69484583 CAGGGAGCAGACAGGAAGAAAGG - Intronic
1098683403 12:73386744-73386766 GAGGGAACAGGTAGGGAAGAAGG + Intergenic
1099123567 12:78723486-78723508 CAAGGAACAGACAAGAAGCAGGG - Intergenic
1099694524 12:86001087-86001109 GAGGGATCAGATATGGAGGATGG - Intronic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100423082 12:94456718-94456740 CAGGGAAGAGACCAGGTGGAGGG - Intronic
1100792254 12:98143404-98143426 CAGGAACTAGAGAGGGAGGAGGG + Intergenic
1100821815 12:98438920-98438942 CAGGGTCCAGTCAGGGAGCAGGG + Intergenic
1101040065 12:100746738-100746760 CAAGAAACACCCAGGGAGGAAGG - Intronic
1101177877 12:102174967-102174989 GAGGGAAGAGACAGGGAGGAAGG - Intronic
1101186640 12:102287806-102287828 CATGAAAGAGACAGGGAGAATGG - Intergenic
1102078601 12:110080012-110080034 AAGGGAGAAGACAGGGAGAAAGG + Intergenic
1102441958 12:112970298-112970320 CAGAGAGGAGTCAGGGAGGAGGG - Exonic
1102521879 12:113482696-113482718 AAGAAAATAGACAGGGAGGAGGG - Intergenic
1103134262 12:118493976-118493998 CAGGGAAAAGGCAGGGAGAAGGG + Intergenic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1103430390 12:120879951-120879973 CAGGGAACAGAGGTGGAGTATGG - Intronic
1103437491 12:120937976-120937998 CATGGAAATGAAAGGGAGGAAGG + Intergenic
1103446159 12:120996560-120996582 CAGGGTGCTGACAGGGGGGAGGG - Exonic
1103602497 12:122063229-122063251 CTGGGAACAGACACGCAGGGAGG - Intergenic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103846893 12:123908094-123908116 CAGGGAGGAGACAGGGAGACAGG - Intronic
1103846904 12:123908151-123908173 CAGGGAGGAGACAGGGAGACAGG - Intronic
1103851872 12:123938634-123938656 CAGGGGCCAGGCAAGGAGGATGG - Intronic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1103989417 12:124788491-124788513 CAGGCATCTGAAAGGGAGGAGGG - Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104410492 12:128553851-128553873 CAGGGAAGAGGCAGGGAGCCAGG + Intronic
1104772867 12:131375126-131375148 GAGAGAAGAGACAGGGAGGAAGG + Intergenic
1104846123 12:131847870-131847892 CAGGGGACAGAGGGGGAGCAGGG - Intronic
1104869348 12:131983518-131983540 CAGGGCACTGACAGGGAGGCCGG + Intronic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1105210856 13:18255996-18256018 CAAGGAGGAGACAGAGAGGATGG + Intergenic
1105874700 13:24541440-24541462 CAGGGAACAGCCTGTGGGGAGGG - Intergenic
1106594530 13:31125186-31125208 CAGCCAGCAGGCAGGGAGGATGG + Intergenic
1106947037 13:34840163-34840185 AAGGGAAGGGACAGGGAGGGAGG + Intergenic
1107345160 13:39452423-39452445 TAGAGAAGAGAAAGGGAGGAGGG + Intronic
1107559284 13:41545659-41545681 AAGGGACCAGAAAGGGAGCATGG - Intergenic
1107920329 13:45200204-45200226 AAATTAACAGACAGGGAGGAGGG + Intronic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109102853 13:58208452-58208474 CAGGGGAGAGTCAGGGAGAATGG + Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1110046708 13:70841472-70841494 CAGGGAAGGAACAGGGAGGTGGG + Intergenic
1110529032 13:76575089-76575111 AAGGGAACAGAAAGGGAGTCAGG - Intergenic
1110553954 13:76837358-76837380 CAGAGAGCAGGCAGGGATGAAGG - Intergenic
1111803595 13:93010019-93010041 CAGGGAAGAGAAAGGAAAGATGG + Intergenic
1112416257 13:99205796-99205818 CATGGAACGGTGAGGGAGGAAGG - Intronic
1112498503 13:99924339-99924361 CTGGAAACAGATAGTGAGGATGG + Intergenic
1112563922 13:100536315-100536337 AAGAGAACAGAGAGGAAGGAGGG - Intronic
1112625408 13:101098052-101098074 CAGGGACCGAACAAGGAGGAAGG - Intronic
1112639059 13:101252258-101252280 CAGAGAACAGAGAGGAAGAAGGG - Intronic
1112786126 13:102953510-102953532 CAGGGGACAGACACGGAAGATGG + Intergenic
1113162234 13:107394852-107394874 CAAGGAACAGGGAAGGAGGAAGG + Intronic
1113404737 13:110027819-110027841 CAGGGTACAGACAGGTGGGTTGG + Intergenic
1114267967 14:21083805-21083827 GAGGACACAGACAGGGATGAGGG - Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1115165040 14:30438752-30438774 TGGGGAGCAGAGAGGGAGGATGG - Intergenic
1115772972 14:36685936-36685958 CAGGGAAAAGATAGGGTGGGGGG - Intronic
1115779637 14:36755439-36755461 CAGGGCACTGACAGGGATGAAGG - Intronic
1116059919 14:39910086-39910108 CAGGGAACAGAAATGAAGGTTGG - Intergenic
1116951323 14:50881306-50881328 CCAGAAAAAGACAGGGAGGAAGG - Intronic
1117399718 14:55347617-55347639 CAGGGAACAGACGTGAGGGAAGG - Intronic
1117502970 14:56372912-56372934 CCTGAAACAGACAGGGAGAATGG - Intergenic
1118101578 14:62610889-62610911 CAGGGAGAAGACTGGGAGGGTGG + Intergenic
1118318214 14:64738246-64738268 CAGGGAGCATGCAAGGAGGAGGG - Intronic
1118381975 14:65224908-65224930 CAGGAAGCAGACAGGAAGGAAGG + Intergenic
1118504888 14:66400311-66400333 AAGAGAAGAGACAGGGAGAATGG - Intergenic
1118685998 14:68291861-68291883 CTGTGAACAGACAGGGAGAAGGG - Intronic
1118905026 14:70017626-70017648 CAGGAAGTAGACTGGGAGGAAGG - Intronic
1119031681 14:71197515-71197537 AAGCCAACAGACAGGGAGGAAGG - Intergenic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1119536844 14:75409648-75409670 GAGGGCAGAGACAGGGAAGAGGG - Intergenic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1119715346 14:76855082-76855104 CAGTGAGGAGACAGTGAGGAAGG + Intronic
1119765918 14:77187567-77187589 CACGGAGCAGCCAGGGAGGAAGG + Intronic
1120013727 14:79446615-79446637 CAGGGAGGGGGCAGGGAGGAGGG - Intronic
1120271629 14:82320694-82320716 CCTGAAACTGACAGGGAGGATGG - Intergenic
1120354801 14:83418138-83418160 CAGATAACAGTCAGTGAGGATGG + Intergenic
1120970671 14:90204533-90204555 CAGGGAAGAGCCAGGGAGCAGGG - Intergenic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121748044 14:96318206-96318228 CAAAGAACAGAAAAGGAGGACGG + Intronic
1122790706 14:104183065-104183087 CGGGGTCCAGACAGGGAGGACGG - Intergenic
1122901117 14:104782682-104782704 CAGGGAACAGACGGCGATCAGGG + Intronic
1122911087 14:104827836-104827858 CAGGGACGGGGCAGGGAGGAGGG + Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1122921557 14:104882451-104882473 GAGGGGCCAGGCAGGGAGGAGGG + Intronic
1123018256 14:105385737-105385759 CTGGGGACAGACAGGGTGGGAGG - Intronic
1123409360 15:20045606-20045628 TAAGGAACAGACAGGGAACAGGG + Intergenic
1123518691 15:21052314-21052336 TAAGGAACAGACAGGGAACAGGG + Intergenic
1124108983 15:26769766-26769788 CACAGAACAGAGAGGGAGGGAGG - Intronic
1124627092 15:31314419-31314441 CAGGGAGATGACAGGGATGATGG - Intergenic
1125285421 15:38087754-38087776 CAGGGCACAGACACGGAGTTCGG - Intergenic
1125481852 15:40086644-40086666 GAGGGATCAGACAGAGAGAAAGG + Intergenic
1125606614 15:40943043-40943065 CAGGGAAGAACCAGGGAGGGGGG - Intergenic
1125624520 15:41096394-41096416 CAGGCAAGAGAAAGGGAGAATGG - Intronic
1126429266 15:48563414-48563436 CAGGGAGCAGGCAGGGAGGAGGG + Intronic
1126604169 15:50459079-50459101 CAGGAAACAGGAAGAGAGGATGG + Exonic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1127156268 15:56128639-56128661 CAGGCAACAGACAAGGAAGGGGG + Intronic
1127410747 15:58704044-58704066 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1127736144 15:61840798-61840820 AAGGGAACAGGGAGGGAGGGAGG - Intergenic
1127762127 15:62149833-62149855 CAGGGAGGAGACAGGAAGGCAGG + Intergenic
1128240933 15:66100440-66100462 CAGAGAACAGACCGGGAGCCAGG + Intronic
1128883310 15:71263109-71263131 GAGGGCAGAGACTGGGAGGAGGG - Intronic
1129065464 15:72900324-72900346 CAGAGAACAGCCATGCAGGATGG + Intergenic
1129253492 15:74321091-74321113 CAGGGACAAGTCGGGGAGGATGG - Intronic
1129843646 15:78758442-78758464 CAGGGAACAGATGGGCATGAAGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130258158 15:82335358-82335380 CAGGGAACAGATGGGCATGAAGG + Intergenic
1130512108 15:84598550-84598572 CAGGGAACTGACAGAGTAGAAGG - Intergenic
1130891443 15:88137118-88137140 CAGGTAACTCACAGGGAGAAAGG + Intronic
1131075227 15:89491211-89491233 GAGGGGACAGGCAGGGAGGATGG - Intronic
1131341758 15:91608890-91608912 CAGGGCACAGGCAGGCAGGGAGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1131979369 15:97980236-97980258 CTGGGATTAGACAGGGAGAAGGG - Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132836964 16:1958994-1959016 CAGGGAGCAGACCAGGAGGCAGG - Intergenic
1132935468 16:2478349-2478371 ATGGGAAGAGCCAGGGAGGAAGG + Intronic
1133055948 16:3145552-3145574 CAAAGGACAGACAGGCAGGATGG - Intronic
1133172907 16:3992772-3992794 CAGGGCACAGGCAAGGTGGATGG + Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133846642 16:9460390-9460412 TAGGGAAGAGGCATGGAGGAAGG + Intergenic
1134018050 16:10902835-10902857 CAGGGAGCAGTCAGGTAGGAGGG - Intronic
1134092528 16:11399216-11399238 CTGGGAACAGATGGGGAAGAAGG - Intronic
1134268442 16:12711922-12711944 CAGGGAAGAGACAGGGGAGGAGG + Intronic
1134776506 16:16858295-16858317 CAGGGAAGAAACTGGGAGGGTGG - Intergenic
1135064550 16:19298639-19298661 AAGGAAACAGACTGGGAGGAAGG - Intronic
1135186057 16:20316902-20316924 AAGGGAAGAGAGAGGGAGAAAGG - Intronic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1135492968 16:22925743-22925765 AAGAGAAGAGCCAGGGAGGATGG + Intergenic
1136005334 16:27325213-27325235 CAGCGAATAGGCAGGCAGGAGGG - Intronic
1136030015 16:27495938-27495960 CAGGGAACCAACAAGGAGGGTGG + Intronic
1136074819 16:27809788-27809810 CAGTGGAAAGACAGGGAGGGTGG - Intronic
1136281172 16:29212322-29212344 CAGGGAACTGAGAGAGGGGAGGG + Intergenic
1136777527 16:32879729-32879751 CAGAGCCCAGTCAGGGAGGATGG + Intergenic
1136867057 16:33767267-33767289 GAGGGACCAGGCATGGAGGAAGG - Intergenic
1136893096 16:33981785-33981807 CAGAGCCCAGTCAGGGAGGATGG - Intergenic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138229223 16:55325160-55325182 TAGGGGACAGACTGGGTGGAGGG + Intronic
1138299184 16:55912138-55912160 CAGGCATCAGACAGGGAAGCAGG + Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138443771 16:57050490-57050512 GAAGGAACAGAAAGAGAGGAAGG + Intronic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138528238 16:57620928-57620950 CATGGAACAGACAGGGAAACAGG - Intronic
1138653127 16:58473139-58473161 AAGGGAAGAGAAAGGGAGGAAGG - Intronic
1138891433 16:61149153-61149175 CAGAGAACTGAAAGGGAGCATGG - Intergenic
1138955213 16:61963244-61963266 CATGGAAGGGACATGGAGGAAGG - Intronic
1139998875 16:71006984-71007006 GAGGGAAGAGACAGGGAGAGAGG - Intronic
1140123380 16:72101757-72101779 CAGTGAAGAGACCAGGAGGAAGG - Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140818920 16:78645583-78645605 CAGAGAACATATAGGGAGAAAGG + Intronic
1140858333 16:78997649-78997671 GAGGGGAGAGACAGGGAGGGAGG - Intronic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141245471 16:82302913-82302935 CAGGGATGAGGCAGGGAGGAGGG - Intergenic
1141361173 16:83396453-83396475 CAGGCAACAGAGAGGAAAGAGGG - Intronic
1141400678 16:83744514-83744536 CAGGGGACAGATGGGGAGAACGG - Intronic
1141983695 16:87565903-87565925 GAGGGGAGGGACAGGGAGGAAGG - Intergenic
1142030664 16:87836843-87836865 GAGGGAAGAGGCGGGGAGGAGGG + Intronic
1142251370 16:88993562-88993584 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1142251404 16:88993652-88993674 GAGGGAAGAGGGAGGGAGGAGGG - Intergenic
1142314174 16:89333035-89333057 CAGGGAACCCCCAGGGAAGAAGG + Intronic
1203079941 16_KI270728v1_random:1141838-1141860 CAGAGCCCAGTCAGGGAGGATGG + Intergenic
1203105107 16_KI270728v1_random:1348936-1348958 GAGGGACCAGGCATGGAGGAAGG + Intergenic
1203128407 16_KI270728v1_random:1613432-1613454 GAGGGACCAGGCATGGAGGAAGG - Intergenic
1142474255 17:180371-180393 CAGGGCTCAGTCCGGGAGGAGGG + Intronic
1142606374 17:1083642-1083664 CAGGGAACAGAGGGAGAGGAGGG + Intronic
1142753583 17:2002643-2002665 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143491106 17:7285681-7285703 TAGGGGCCAGACAGGGAGGGTGG - Intronic
1143705829 17:8697165-8697187 CAGGGACCTGCCAGGGAGGAAGG + Intergenic
1144115950 17:12090646-12090668 GTGGGAAGAGACAGGGAGAAGGG - Intronic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144731219 17:17527516-17527538 CAGGAAACAGGCAGAGAGAAAGG - Intronic
1144769019 17:17748903-17748925 AAGGGCACAGGCAGGGAGGGGGG - Intronic
1144830580 17:18128827-18128849 CAGAGAGCTGTCAGGGAGGACGG + Intronic
1145017054 17:19406108-19406130 CAGAGATCTGACAGGGTGGATGG + Intergenic
1145865206 17:28236722-28236744 GAGGCACCAGACAAGGAGGAAGG - Intergenic
1146489643 17:33271173-33271195 GAGGGAACAGTCAAGGAGGTAGG - Intronic
1146916636 17:36682290-36682312 CATGGAGCAGTGAGGGAGGACGG - Intergenic
1147628612 17:41915839-41915861 CAAGGAACACTCAGAGAGGAGGG + Intronic
1148071068 17:44908888-44908910 CAGGAAAGAGAAAGGAAGGAAGG + Intronic
1148204450 17:45771145-45771167 AGGGGCAGAGACAGGGAGGAAGG + Intergenic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148579640 17:48734680-48734702 GAGGGAGGAGAAAGGGAGGAAGG + Intergenic
1148651372 17:49252432-49252454 CAGGCACCAGGCAGGGAGCAAGG + Intergenic
1149466822 17:56886545-56886567 CAGGAAGCTGGCAGGGAGGAAGG + Intergenic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1150467041 17:65402847-65402869 CAGGGGAGAGACAGTCAGGAGGG + Intergenic
1151296540 17:73190540-73190562 CAGGGGACAGGCAGGAAGGAAGG + Intergenic
1151366594 17:73621084-73621106 CAGGCACCAGAAAGTGAGGATGG + Intronic
1151713908 17:75821886-75821908 CAGGACACAGACAGGGAGTGTGG - Intronic
1152002339 17:77654598-77654620 CAGGGAGCAGACAGGAGGGGTGG - Intergenic
1152146138 17:78570029-78570051 GAGGGAAAAGAAAGGGAAGACGG - Intronic
1152181707 17:78826098-78826120 CTGGGATCATACAGGGAGCAAGG + Intronic
1152196435 17:78921184-78921206 CAGGGACCAGACAGATAGTAGGG - Intronic
1152341617 17:79728948-79728970 GAGGGACCAGGCATGGAGGAAGG - Intergenic
1152470229 17:80487095-80487117 CAGGAAACAGCCACGCAGGAAGG - Intergenic
1152565009 17:81096467-81096489 CAGGGAACTGCCAGGGATGCTGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152784367 17:82240328-82240350 CAGGGAGCAGACGAGGAGGTGGG + Intronic
1152825970 17:82465067-82465089 CAGGGAACAACCATGGCGGAAGG + Intronic
1203162907 17_GL000205v2_random:68198-68220 CAGGGACCAGACTGGGAGCTCGG + Intergenic
1153321243 18:3776104-3776126 GAGGGAAAAGACGGGGAAGATGG + Intronic
1153394148 18:4598814-4598836 TAGAGAACAGAAATGGAGGATGG + Intergenic
1154134187 18:11761418-11761440 CAGAGAACAGGCAGGAAGGGAGG - Intronic
1154188630 18:12208855-12208877 CAGGGATCACCCAGGGTGGATGG + Intergenic
1155135322 18:22985991-22986013 CAGGGAAGGGACTGGGGGGAGGG - Intronic
1155320461 18:24613915-24613937 CAGAGAACAGTCAGCCAGGAGGG + Intergenic
1155389239 18:25316187-25316209 CATGGAACGGGCAGGGAGAAAGG + Intronic
1155823839 18:30413495-30413517 GAGGGAGGAGAAAGGGAGGATGG + Intergenic
1156095866 18:33531078-33531100 CTGGGAACAGACATGGAGTGGGG + Intergenic
1156341581 18:36214509-36214531 CAGGGAAGAGACAGGGAGGGTGG - Intronic
1156468300 18:37361898-37361920 CCGGGAAGAGAAAGGCAGGAGGG + Intronic
1156472597 18:37387198-37387220 CCGGGAAAAGGCAGGGAGGAAGG - Intronic
1156542255 18:37925753-37925775 CAGAAGACAGACAGGGAAGAAGG + Intergenic
1156805374 18:41172798-41172820 TAGGGAAAAGAATGGGAGGAGGG - Intergenic
1157389400 18:47288618-47288640 CAGGAAACAGACAGTCAGAAGGG - Intergenic
1157772150 18:50358633-50358655 GAGGGAAAAGAAAGGGAAGATGG - Intergenic
1158432416 18:57401237-57401259 CAGGGAATAGCCAGAGTGGAGGG + Intergenic
1158438614 18:57453148-57453170 TAGGGGACAGGCAGGGAAGAAGG - Intronic
1160263268 18:77315599-77315621 CAGGGTGCAGGCTGGGAGGAGGG - Intergenic
1160355940 18:78228947-78228969 GTGGGAACAGACAGGAAGGGTGG + Intergenic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1160758788 19:772121-772143 AAGGGGGGAGACAGGGAGGAGGG - Intergenic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161431281 19:4233687-4233709 CAAGGGGGAGACAGGGAGGAGGG - Intronic
1161550245 19:4908899-4908921 AGTGGAACAGACAGGGCGGAGGG + Intronic
1161573017 19:5040666-5040688 GAGGCCACAGACAGAGAGGAGGG - Intronic
1161644504 19:5444725-5444747 CAAGGGGGAGACAGGGAGGAGGG - Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1161927640 19:7313034-7313056 CCGGGAACAGGGAGGAAGGAAGG - Intergenic
1162439766 19:10685899-10685921 CAGCGAGGAGACTGGGAGGATGG - Intronic
1162651471 19:12092106-12092128 CAGGGCACAGGGAGGGAGGTGGG + Intergenic
1162666855 19:12220668-12220690 CAGTGAACCGACAGGGGGCAGGG - Intergenic
1162676379 19:12301565-12301587 CAGGGCACAGCCGGGGAGGGTGG + Intergenic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1163102031 19:15103637-15103659 CAGGGATCTCATAGGGAGGAGGG + Intergenic
1163386965 19:17005670-17005692 CAGGGAAGGGACAGGGAGAGTGG + Intronic
1163395888 19:17061090-17061112 CAGGGCACAGACTGGGAGCCTGG + Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1164667546 19:30051523-30051545 GAGGAAACAGAAAAGGAGGAGGG - Intergenic
1164744217 19:30599332-30599354 GAGGGATCAGGGAGGGAGGAAGG - Intronic
1164849319 19:31468388-31468410 AAGGGAGCAGGAAGGGAGGAGGG + Intergenic
1165052591 19:33151440-33151462 CTGGGGACAGGCAGGCAGGAGGG + Intronic
1165278946 19:34780573-34780595 AAAGAAAGAGACAGGGAGGAGGG + Intergenic
1165293297 19:34906096-34906118 CAGAGAAGATGCAGGGAGGAAGG + Intergenic
1165742419 19:38211841-38211863 CAAGGGACAGAGAGGGAGGGAGG + Exonic
1165940023 19:39410281-39410303 GAGGGAAGTGAGAGGGAGGAGGG - Intergenic
1166633294 19:44427036-44427058 CAGGAGAGAGACAGCGAGGAAGG + Exonic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1166823271 19:45593668-45593690 CATGTCACAGACAGGGAGAAGGG + Intronic
1166975744 19:46604121-46604143 CAGGGAAAGAACAGAGAGGAGGG - Intronic
1166976931 19:46610291-46610313 GAGGGAAGAGGCAGGGAAGAGGG - Exonic
1167690371 19:50981188-50981210 CAGAGACCAGAGAGAGAGGAGGG + Intronic
1168113469 19:54207988-54208010 CAGGCAAGAGACAGGTGGGACGG + Intronic
1168323898 19:55528245-55528267 CAGAAAAGAGACAGAGAGGAAGG - Intergenic
925200575 2:1965108-1965130 CAGGGATCAGGCAGGGAAGAGGG + Intronic
925200608 2:1965246-1965268 CAGGGACCAGGCAGGGAAGAGGG + Intronic
925371979 2:3352363-3352385 TCGGGAACAGACAGTGTGGATGG - Intronic
925870102 2:8262940-8262962 CAGGGATGAGACATGGTGGAAGG - Intergenic
925887338 2:8404139-8404161 GAGAGAACAGGCAGAGAGGAAGG - Intergenic
925902060 2:8515849-8515871 TAGGGAAGAGGAAGGGAGGAAGG - Intergenic
926001405 2:9336290-9336312 CAGGGGAGAGAAAGGGAGGGAGG - Intronic
926062509 2:9813281-9813303 CAGGGAACAGACAGTGCTGTGGG + Intergenic
926229743 2:10993263-10993285 CAGGGAGCAGGCGGGGAGGCTGG + Intergenic
926689864 2:15725731-15725753 CAGGGAGCAGAGAGAGAGGGGGG + Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927208822 2:20626449-20626471 CAGGGAAGGGACAGGCAGGCTGG + Intronic
927241152 2:20920396-20920418 CAGGGACCAGCCAGGCAGGGTGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927956238 2:27209207-27209229 TGGAGAACAGACAGGGTGGATGG - Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928608381 2:32965482-32965504 CAGGGTTTAGACAGGAAGGAGGG - Intronic
929606936 2:43240969-43240991 AAGGGCACAGACAGGGACGAGGG - Intronic
930048608 2:47195368-47195390 CAGGAAACAGACTGGGAAGCAGG - Intergenic
930108608 2:47658981-47659003 GAGGGAGCAGGCAGGCAGGAGGG - Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
931187404 2:59966826-59966848 AAAAGAAAAGACAGGGAGGAGGG + Intergenic
932344525 2:70986905-70986927 AAAGGAACAGCCAGGGAGGTAGG + Exonic
932411073 2:71548203-71548225 CAGGGCAAAGACAGCAAGGAGGG - Intronic
932777500 2:74536841-74536863 CAGGGAACAGAGGGAGAGGTGGG + Exonic
932833617 2:75013577-75013599 CTGGGCACTGACAGGCAGGAGGG + Intergenic
932886305 2:75552349-75552371 GAGAGAAGGGACAGGGAGGAGGG - Intronic
933589699 2:84218591-84218613 CATGATACAGATAGGGAGGAAGG + Intergenic
933730920 2:85455805-85455827 CAGGGGACAGACAAGCAGGAAGG + Intergenic
934035859 2:88088098-88088120 GAGGAGACAGACAGGGAGGATGG - Intronic
935028629 2:99301454-99301476 AAGGGAAGAGGAAGGGAGGAAGG + Intronic
935029358 2:99307051-99307073 AAGGGAAGAGGAAGGGAGGAAGG - Intronic
935209100 2:100923230-100923252 CCAAGAACAGACAGGGAGGAGGG + Intronic
935286437 2:101567872-101567894 AAGGGAACAATCAGGGAAGAAGG - Intergenic
935337372 2:102029192-102029214 GAGGGGACAGAGAGGAAGGAAGG - Intergenic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935795277 2:106634917-106634939 CAGACCACACACAGGGAGGAAGG + Intergenic
936460572 2:112711304-112711326 CCGGGAACAACCAGGTAGGATGG - Intergenic
937256846 2:120561674-120561696 CAGGAAAGAGAAAGGGAGGGAGG - Intergenic
937263388 2:120600780-120600802 AAGGGCACAGACAGCCAGGAAGG - Intergenic
937501582 2:122484859-122484881 AACGGTACAGAAAGGGAGGAAGG - Intergenic
937825380 2:126363538-126363560 CATGGCAGAGGCAGGGAGGAAGG - Intergenic
937968548 2:127533000-127533022 CAGGGTCCATCCAGGGAGGATGG + Intergenic
937975709 2:127581108-127581130 TAGGGACCTGACAGGGTGGAGGG - Intronic
938081187 2:128371034-128371056 GAGGGACCAGAGAAGGAGGACGG - Intergenic
938122670 2:128644853-128644875 CAGGGAGGAGGAAGGGAGGAGGG - Intergenic
938248919 2:129798809-129798831 CAGGGAGGACACAGGGAGTAAGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938308145 2:130268333-130268355 CAGGGAAGTGAAAAGGAGGAGGG - Intergenic
938447186 2:131388503-131388525 CAGGGAAGTGAAAAGGAGGAGGG + Intergenic
938645887 2:133329559-133329581 AAAGAAACAGAAAGGGAGGATGG + Intronic
938667937 2:133558470-133558492 AAGGGAGCAGCCAGGGAAGATGG + Intronic
939223858 2:139339874-139339896 GAGGGGACAGAGAGAGAGGAGGG + Intergenic
939284830 2:140115329-140115351 AAGGTAACTGACAGTGAGGAAGG + Intergenic
939633495 2:144552984-144553006 AAGGGAAAAGAAAGGAAGGAAGG + Intergenic
939865816 2:147471300-147471322 AAGGGAACACACAGGAAGCAAGG + Intergenic
939990343 2:148872506-148872528 CAGGAAACAGGAAGAGAGGATGG - Intergenic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
940554775 2:155209900-155209922 AAGGAAACAGAAAGGAAGGAAGG + Intergenic
940638599 2:156326644-156326666 AAAGGAAAAGAAAGGGAGGAAGG - Intronic
941170039 2:162125276-162125298 TGGAGGACAGACAGGGAGGAGGG - Intergenic
942301012 2:174562460-174562482 AAGGGAAGAAGCAGGGAGGAGGG + Exonic
942385213 2:175435476-175435498 AAGGGAAGATCCAGGGAGGATGG - Intergenic
944033743 2:195268299-195268321 CAGGAAAGTGACAGGGAGAATGG - Intergenic
944229774 2:197380953-197380975 CAGAGAACAGCCACGCAGGACGG + Intergenic
944970305 2:204985189-204985211 GAGGGAAAAAACAGGCAGGAGGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945995440 2:216432368-216432390 CAGGGGACGTACATGGAGGAGGG - Intronic
946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG + Intronic
946403887 2:219482971-219482993 CAGGGAACAGGCAGGAAGCTAGG - Intronic
946716224 2:222556942-222556964 CAGGGAGAAGTCAGGGTGGATGG - Intronic
946973696 2:225123450-225123472 GAAGGAAAAGAAAGGGAGGACGG - Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947449541 2:230194480-230194502 AAAGGAACAGAAAGGGAAGAGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948381983 2:237557055-237557077 GAGAGAACAGAGAGGGAGGGAGG - Intergenic
948708296 2:239809471-239809493 CAGCGCCCACACAGGGAGGAGGG - Intergenic
948718843 2:239883468-239883490 CAGGGAACAGACACAGTGGCAGG - Intergenic
948730376 2:239959750-239959772 AAGGAAAGAGGCAGGGAGGAAGG + Exonic
948767742 2:240232233-240232255 ACGGGAACAGACTGGGAGAAGGG + Intergenic
948790527 2:240374339-240374361 AAGGGACCAGAGAAGGAGGATGG + Intergenic
948815943 2:240510343-240510365 CAGGGAGGAGTCAGGGAGGCGGG - Intronic
1168742713 20:207096-207118 CAGAGAACAGCCACGCAGGACGG - Intergenic
1168866279 20:1089738-1089760 AATGGAGCAGACAGGGAGGAAGG + Intergenic
1169087736 20:2837882-2837904 GAGTGGAAAGACAGGGAGGAAGG - Intronic
1169719381 20:8657109-8657131 CAGAGAAAAAACAGGGAGGGAGG + Intronic
1169922411 20:10749449-10749471 ATGGGAACAGTCAGGGAGGGAGG + Intergenic
1169945695 20:10985685-10985707 CAGGGAAAAGAAATAGAGGACGG - Intergenic
1169969077 20:11249161-11249183 CAGGGAAGAGAAAGGGATAAGGG - Intergenic
1170212129 20:13856030-13856052 CAAGGTACAGACAGAAAGGATGG + Intronic
1170415726 20:16138021-16138043 AAAGGCACAGACAGGGAGAATGG + Intergenic
1170803049 20:19606190-19606212 CATGGAACAGGCAGGCAGGCAGG - Intronic
1171031642 20:21682056-21682078 CACGAAACTGAGAGGGAGGAGGG - Intergenic
1171274949 20:23848523-23848545 CAGGCAAGAGAAAGGGAGTAGGG + Intergenic
1171291996 20:23987685-23987707 CAAGGAGGAGACAGAGAGGATGG + Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171370872 20:24661321-24661343 GAGGGAAGAGAGGGGGAGGAAGG + Intronic
1171376965 20:24700299-24700321 GGGGGAACAAACAGGAAGGAGGG - Intergenic
1171408189 20:24928065-24928087 CAGGCCCCAGACAAGGAGGATGG + Intergenic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1171468928 20:25354326-25354348 CAGGAAACAGGCAGGCAGGAAGG + Intronic
1171985615 20:31658906-31658928 CAAGGAAGAGAGAGGAAGGAAGG - Intergenic
1172165279 20:32895030-32895052 GAGGGAAGAGACAGCAAGGATGG - Intronic
1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG + Intergenic
1172317983 20:33971223-33971245 CAGGGAAGGGGCAGGAAGGATGG - Intergenic
1173349554 20:42232632-42232654 CAGGGAACAGTCTGGGAGTGGGG - Intronic
1173594446 20:44249544-44249566 CTGGGACCAGACAGGGGGCAGGG + Intronic
1173638568 20:44582591-44582613 CGGGGAAGAGACAGAGAGGAGGG + Exonic
1173726980 20:45305068-45305090 CAGGGACCAGGCAGGGAACATGG + Intronic
1173851296 20:46220087-46220109 GAGGAAAGAGACAGAGAGGAAGG + Intronic
1173946418 20:46954352-46954374 AGGGAAACAGACAGGGAGGAAGG + Intronic
1174140669 20:48411249-48411271 CAGAGAAGAGACGGGGAGGGAGG + Intergenic
1174508045 20:51029626-51029648 CAGGGACCAGACAGGTAGACAGG - Intergenic
1174615047 20:51829018-51829040 CAGGGAAAAGCCAGGGAGCCAGG - Intergenic
1174691653 20:52512335-52512357 TGTGGAACAGACAGGGAGGAAGG - Intergenic
1175220043 20:57411647-57411669 CAGTGCACAGGCAGGCAGGAAGG + Intergenic
1175514493 20:59560192-59560214 CAAGGAACGGAAAGAGAGGACGG + Intergenic
1175550050 20:59811640-59811662 CAGGGCAAAGACAGGGGGGTTGG + Intronic
1175584945 20:60131766-60131788 CTGGAAACAGAGAGAGAGGACGG + Intergenic
1175667702 20:60874194-60874216 CAGGGAACAGGGTGGGCGGAAGG + Intergenic
1176060804 20:63172034-63172056 CAGGGAAGAGACAGCGACCAGGG + Intergenic
1176060811 20:63172070-63172092 CAGGGAAGAGACAGTGACCAGGG + Intergenic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176165004 20:63668151-63668173 CCGGGCACACACTGGGAGGAGGG - Intronic
1176286478 21:5021692-5021714 CAGGGATCAGGGAGGGAGGGCGG + Intergenic
1176552488 21:8232981-8233003 GAGAGAACAGACAGGGAGGGGGG - Intergenic
1176588244 21:8611306-8611328 CAGGAATCAGAAAGGGAGAAAGG + Intergenic
1176672210 21:9745182-9745204 GAGAGAAGAGAAAGGGAGGAGGG + Intergenic
1176920554 21:14683196-14683218 GAGGGAACAGGGAGAGAGGAAGG + Intergenic
1177269425 21:18827466-18827488 AAAGGAATGGACAGGGAGGAAGG + Intergenic
1177402699 21:20626077-20626099 CAAGGAAAAGACAAAGAGGAAGG + Intergenic
1177648472 21:23930662-23930684 GGGGGAACAGGAAGGGAGGAAGG + Intergenic
1177708593 21:24740916-24740938 GAGGGGAGAGAAAGGGAGGAGGG - Intergenic
1177969182 21:27767219-27767241 CATGGAACAGAAAAGGAAGAAGG - Intergenic
1178687724 21:34724296-34724318 TAAGGAAGAGATAGGGAGGAAGG + Intergenic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179020477 21:37636129-37636151 CAGGGAAAAGGCAGGGAAAAGGG - Intronic
1179030028 21:37712471-37712493 GAGGGAAGAGAAAGGGAGGAGGG - Intronic
1179030043 21:37712516-37712538 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030089 21:37712656-37712678 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030102 21:37712701-37712723 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179112580 21:38460188-38460210 CCAAGAACAGCCAGGGAGGAGGG + Intronic
1179362741 21:40727826-40727848 CAGAGAAGAAACAGTGAGGATGG - Intronic
1179712830 21:43272974-43272996 CAGTGAACATCCAGGGAGCAGGG - Intergenic
1179870703 21:44241783-44241805 CAGGGATCAGGGAGGGAGGGCGG - Intergenic
1179880758 21:44292477-44292499 CAGGGGACAGACGGACAGGAGGG - Intronic
1180271076 22:10588302-10588324 CAGGAATCAGAAAGGGAGAAAGG + Intergenic
1180965185 22:19784484-19784506 CAGGTAACACGCAGGGAGGAAGG + Exonic
1181100383 22:20534943-20534965 CAGGAAGCAGACAGGGAGGTAGG + Intronic
1181270737 22:21657303-21657325 GAGGCTACAGACAGCGAGGAGGG + Intronic
1181273287 22:21673328-21673350 CAGGGCACAGGCAGGCAGCAGGG - Intronic
1181456218 22:23061550-23061572 CAGGGAACAGACTGGTGCGAAGG + Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181660200 22:24341167-24341189 CAGGGCAGATACTGGGAGGAGGG + Intronic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181928973 22:26383997-26384019 AAGGGAAAAGGCAGGAAGGAGGG + Intergenic
1182023997 22:27103034-27103056 CAGGGAGGGGGCAGGGAGGATGG + Intergenic
1182103265 22:27671990-27672012 GAGGGAGCAGGGAGGGAGGAAGG + Intergenic
1182783951 22:32891027-32891049 CAGGGAACAGCCAAAGAGGTGGG - Intronic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183354521 22:37351088-37351110 CAGGGGACCGCAAGGGAGGAGGG - Intergenic
1183520690 22:38294603-38294625 CAGGGCACAGAAGGGGAGGGAGG + Intronic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1183809942 22:40247068-40247090 CAGACAACAGACAGGGCAGAGGG - Intronic
1183899479 22:40994138-40994160 CAGGGAAATGACAGAGAGGTTGG + Intergenic
1183928568 22:41223300-41223322 CAGGGAACAGGTAGGGTGTAGGG - Intronic
1184056343 22:42052801-42052823 CAGGTGAGAGACAGGGAGGCTGG - Intronic
1184563418 22:45276612-45276634 CAGGTAAGACACAGGGAGTAGGG - Intergenic
1184781139 22:46650278-46650300 CAGGGAAGTTACTGGGAGGAAGG - Intronic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1185008396 22:48299325-48299347 CAGGTCACAGCCAGGCAGGAAGG + Intergenic
1185063600 22:48619952-48619974 CATGTCACAGCCAGGGAGGAGGG - Intronic
1185098628 22:48825676-48825698 AAGGGAGCAGGCAGGGAGGAGGG + Intronic
1185209694 22:49563741-49563763 CAAGGAAGAGAGGGGGAGGAGGG + Intronic
1185375327 22:50480391-50480413 CAGGGAACAGTGGGGAAGGAGGG - Intergenic
949759951 3:7459346-7459368 TGGGGAGCAGAGAGGGAGGAAGG + Intronic
950185032 3:10939596-10939618 GAGAGAACTGAGAGGGAGGATGG - Exonic
950642899 3:14359932-14359954 AAGGGGACAGACAGGGAGACAGG + Intergenic
950677521 3:14563623-14563645 GAGGGAGAAGGCAGGGAGGAGGG + Intergenic
950880872 3:16321783-16321805 CAGGGAAAATTCAGAGAGGATGG - Intronic
950893446 3:16426068-16426090 CAGAGAGCAGACATTGAGGAAGG - Intronic
951004124 3:17597338-17597360 GGGGGAGGAGACAGGGAGGAAGG - Intronic
951350858 3:21605208-21605230 CTAGGAACAGACAGGGAGTTGGG + Intronic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
952773361 3:37021968-37021990 GAGGGAAGAGACATGGAGGCTGG + Intronic
953415146 3:42711543-42711565 CAGGGAGGAGGCAGGGAGGCTGG - Intronic
953475969 3:43206115-43206137 CAGGAGACAGAAAGGGAGGCAGG + Intergenic
953602429 3:44379890-44379912 TAGGGAAGAGAGTGGGAGGAGGG + Intronic
953784046 3:45897098-45897120 CAGGACACAGACAGGCAGGATGG + Intronic
954076770 3:48187688-48187710 CAGGAAACGGACCGGGAGAAGGG - Intronic
954160992 3:48722056-48722078 CAGGAACTAGACAGGGATGATGG + Intronic
954314942 3:49795905-49795927 CCTGGAACAGTGAGGGAGGAAGG - Intronic
954437480 3:50503705-50503727 CCGGGAAGAGAGAGGGAGGGAGG - Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
955327325 3:58019301-58019323 GAGGGGACAGACAGGGAGTGGGG - Intronic
956260594 3:67336156-67336178 CTGGGAACAGACGGGGAGAGGGG + Intergenic
957586941 3:82144916-82144938 CAGAGAGCAGACTGGGAAGAGGG + Intergenic
957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG + Intergenic
959103346 3:102039087-102039109 GAAAGAAAAGACAGGGAGGAAGG - Intergenic
959856635 3:111166358-111166380 CAGGGATCAGAAAAGGAGCATGG - Intronic
960195880 3:114767583-114767605 AAGGAAACAGAAAGGGAGGAGGG + Intronic
960549338 3:118956533-118956555 CAGGGAACAGGCAGGACAGAGGG + Intronic
960972372 3:123149069-123149091 GAGGACAAAGACAGGGAGGAAGG + Intronic
961109411 3:124271241-124271263 CAAGGGACAGAAAGGGAGGTGGG + Intronic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
963051108 3:141144778-141144800 CAGGCAACACACAGGGAGTTGGG + Intronic
963143904 3:141972493-141972515 TAGGGAACAGGCATGGAGAAAGG - Intronic
963153549 3:142072106-142072128 CAGGGAACAGCCAAAAAGGAAGG + Intronic
963339143 3:144013259-144013281 CAGGTAACAGGCAGGGACTAAGG - Intronic
963502062 3:146139883-146139905 GAGGAAAGAGAAAGGGAGGAAGG - Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963705941 3:148688471-148688493 TAGGGAACTGACAAGGAGGCAGG - Intergenic
963734465 3:149004157-149004179 CAGGTGAGAGACAGGGAGAAAGG - Intronic
964394803 3:156234183-156234205 AGAGGAACAGACAGTGAGGAAGG + Intronic
964812868 3:160684351-160684373 CCCAGAACAGACAGGGAAGAGGG + Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965282329 3:166770041-166770063 CAGGCAACAGACAGAGAGCCTGG + Intergenic
965526466 3:169724552-169724574 CAGGGATTAGGGAGGGAGGAAGG + Intergenic
965716144 3:171605259-171605281 CAGTGAAAAGAAACGGAGGAGGG + Intronic
965779822 3:172273423-172273445 CGGGGAATATACAGGGAGCAGGG - Intronic
966573656 3:181475992-181476014 CAAGAAAAAGACAGGGAGAATGG - Intergenic
966958560 3:184910052-184910074 CAGGGGTCAGACAGTGATGAGGG + Intronic
967009918 3:185423228-185423250 CACGGACCAGGCAGGGGGGATGG - Intronic
967221318 3:187250330-187250352 CTGGGAAGAGACAGGAAGAAGGG + Intronic
967458718 3:189720777-189720799 CAGGGAGCAGATAGGGAGATAGG + Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
967883103 3:194315423-194315445 CAGAGAACAGCCAGGGAAGATGG + Intergenic
968287376 3:197516970-197516992 CAGCTAACAGGCAGGGAGGGTGG + Intronic
968361049 3:198147158-198147180 CAGGGGACAGACAGGCAGAGCGG + Intergenic
968517799 4:1022167-1022189 CGAGGAACAGTCAGCGAGGAGGG - Intronic
968551582 4:1226243-1226265 CAGGGACAAGCCAGGGATGAGGG - Intronic
968653674 4:1769767-1769789 CAGGGATGAGACAAGGAGGCAGG - Intergenic
968800754 4:2742057-2742079 CAGGGAACTGCCAGTGAGGCTGG - Exonic
968829521 4:2925663-2925685 CAGGGAGAAGGCAGGGAGGGAGG + Intronic
968836285 4:2966891-2966913 CAGGGACCAGAGAGGGAGGGGGG - Intronic
968935726 4:3609179-3609201 CACGGCACTGACAGGGAAGAGGG + Intergenic
969108974 4:4829462-4829484 CAGGGAAAATGCAGGGAAGAGGG - Intergenic
969471303 4:7390957-7390979 CAGTGACCACTCAGGGAGGAGGG + Intronic
969481445 4:7448956-7448978 GAGGGAAAAGACAGGAAGGGAGG - Intronic
969489485 4:7490994-7491016 CAGGGCAGGGACAGAGAGGAGGG - Intronic
969608027 4:8211951-8211973 CAGGGGACAGACAGGAGGGAGGG + Intronic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
970342129 4:15118499-15118521 CAGGGAACAGACGTGGAGGTGGG - Intergenic
971097396 4:23423419-23423441 CAGGCAGAAGACAGTGAGGATGG + Intergenic
971358178 4:25913526-25913548 CAGGGAACAGGGAGAGAGGATGG + Intronic
971394347 4:26214675-26214697 GAGGGAGGAGAGAGGGAGGAAGG + Intronic
971493111 4:27235327-27235349 CAGAGAAAAGACAGTGGGGATGG - Intergenic
971588318 4:28433201-28433223 CAGGGAAATGACAGGGAACATGG - Intergenic
971609029 4:28697938-28697960 GAGGGAACAGAAAGGGAGGGAGG - Intergenic
971703200 4:30007259-30007281 CAGGGAGGAGAGTGGGAGGAGGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972565522 4:40265676-40265698 GAGGGAAGGGAGAGGGAGGAGGG + Intergenic
973892034 4:55376877-55376899 GAAGGAACAGCCAGGGAGGTAGG - Intergenic
975148425 4:70994385-70994407 CAGGGAATAGGAAGGGTGGAGGG - Intronic
975220214 4:71805620-71805642 CAGGGAGCAGTCAGGCAGCATGG + Intergenic
975220789 4:71810136-71810158 CAGGGAGCAGTCAGGCAGCATGG + Intergenic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
976143063 4:82013159-82013181 CAGAGAACAGCCACGCAGGATGG + Intronic
976162663 4:82220138-82220160 CACAGAGCAGATAGGGAGGAAGG + Intergenic
976163139 4:82225150-82225172 AAGGGAATAGACAGAGAAGAAGG - Intergenic
977377438 4:96223783-96223805 CAAAGAAGAGACAGGCAGGATGG + Intergenic
977414914 4:96720934-96720956 CATGAAAGAGACAGGGAGAATGG - Intergenic
977625386 4:99184281-99184303 GAGGGTATAGACAGGGAGAAGGG - Intergenic
978949751 4:114543832-114543854 CACGGAGCAGTCAGGGAGGTGGG + Intergenic
982397093 4:154924579-154924601 CATGAAAGAGACAGGGAGAATGG - Intergenic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982648785 4:158059586-158059608 AAGGGATCAGGCAGGGAAGAAGG - Intergenic
983551849 4:169025794-169025816 CAGTGAGCAGTGAGGGAGGACGG + Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
985001716 4:185491616-185491638 CAGAAAACAGACAGGCAGGCTGG - Intergenic
985402523 4:189606666-189606688 GAGAGAAGAGAAAGGGAGGAGGG - Intergenic
985766959 5:1785164-1785186 CAGGAAACTGAGCGGGAGGAAGG - Intergenic
985818271 5:2142779-2142801 CAGAAAACACACAGGGAAGAAGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986042352 5:4005733-4005755 CAGAACACAGTCAGGGAGGATGG - Intergenic
986047159 5:4050272-4050294 CAGAGAGGAGACTGGGAGGAAGG + Intergenic
986154025 5:5155842-5155864 CAGGGGACAGACAGGAAGTGAGG + Intronic
986154043 5:5155926-5155948 CAGGGAACAGACAGAAAGTGAGG + Intronic
986154058 5:5156010-5156032 CAAGGAACAGACAGGAAGTGAGG + Intronic
986347490 5:6848352-6848374 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
986784754 5:11103930-11103952 CAAGGAGCAGTCAGGGAGTATGG + Intronic
988339247 5:29948916-29948938 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
988592926 5:32564725-32564747 CAGGGGACAAACAGGAAGCATGG + Intronic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989196271 5:38719641-38719663 GAGGGAAGAGAAAGGAAGGAAGG - Intergenic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
990012867 5:51021330-51021352 CAGGGGACTGTCAGGGAGAAAGG - Intergenic
990504822 5:56433823-56433845 AAAGGAACTGAGAGGGAGGATGG + Intergenic
991597584 5:68321342-68321364 AAGGAAAGAGACAGGGAGGAAGG - Intergenic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
993089624 5:83409297-83409319 CATGAAAGAGACAGGGAGAATGG + Intergenic
993135204 5:83952207-83952229 AAGGTAACAGTCAAGGAGGATGG - Intronic
993524210 5:88944521-88944543 CAGAGAACTTCCAGGGAGGAAGG + Intergenic
994513088 5:100733146-100733168 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
994551254 5:101238158-101238180 CCTGAAACAGACAGGGAGAATGG - Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994944043 5:106361925-106361947 GATGGAAGAGAAAGGGAGGAGGG - Intergenic
996748849 5:126869159-126869181 AAAGGAACAGGCAGCGAGGAGGG - Exonic
997093312 5:130882561-130882583 CAGAGGACAGACAGGCAAGAGGG + Intergenic
997259356 5:132454266-132454288 CAGGAGAGAGACAGGCAGGAGGG - Intronic
997578911 5:135005047-135005069 CCAGGACCACACAGGGAGGAGGG + Intronic
997941649 5:138163039-138163061 AAGAGAAAAGACAGGAAGGAAGG + Intronic
998205344 5:140153484-140153506 GTGGGACCAGGCAGGGAGGAAGG + Intergenic
998207210 5:140166434-140166456 TAGGGTGCAGACAGGGAGGCAGG + Intergenic
998511131 5:142714858-142714880 CAGGAGAGAGACAGGAAGGATGG - Intergenic
999443591 5:151621313-151621335 CAGGGATCTCACAGGAAGGATGG - Intergenic
999759857 5:154691654-154691676 CAGGGAACAGGGACGGAGGGAGG - Intergenic
999809698 5:155115741-155115763 CACAGAACAGACAGGGACCAAGG - Intergenic
1000019448 5:157306448-157306470 TGGGGAACAGAGAGGGAAGAAGG - Intronic
1000588227 5:163126268-163126290 GAGGGAACAGAGAGGGAGTGGGG + Intergenic
1000731405 5:164838679-164838701 AAGGGAACAGAAAGGGAAGGAGG - Intergenic
1000810847 5:165858918-165858940 CAGGAAACAGTCATGGAGAAAGG + Intergenic
1000957930 5:167564161-167564183 AAAGGAACAGAAAGGGAGGATGG + Intronic
1000974984 5:167754892-167754914 AAGGGAGCAGAAAGGGAGGAGGG + Intronic
1001298377 5:170515338-170515360 AAGGGAAAAACCAGGGAGGAGGG - Intronic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1002467948 5:179417180-179417202 AAGGGAGCAGACAGCAAGGACGG + Intergenic
1002521095 5:179793636-179793658 CAGGGAACAGATAAGGTGGGTGG + Intronic
1002643058 5:180639786-180639808 CAGACAACAGCCAGGCAGGAAGG - Intronic
1002852693 6:1010577-1010599 TAGGCAACTGACAGGAAGGAAGG - Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003130978 6:3394996-3395018 CAGGTATGAGGCAGGGAGGACGG + Intronic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1003833764 6:10044249-10044271 CAGAAAACACACAGGGAAGAAGG - Intronic
1004024666 6:11806853-11806875 CAGTGGTCAGGCAGGGAGGAAGG + Intronic
1004443155 6:15672576-15672598 CAGGGTACAGTCTGGGAGCATGG + Intergenic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004725648 6:18308917-18308939 AAGGGAAGAGAGAGAGAGGAAGG - Intergenic
1004758567 6:18640801-18640823 AAGGGAACAGAGATAGAGGAAGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1006043757 6:31275798-31275820 CAGGAAACAGGAAGAGAGGATGG + Intronic
1007073196 6:39050855-39050877 CAGGGAAGAGAAAGGGGTGAAGG + Intronic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007292744 6:40799585-40799607 AAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1007777812 6:44233555-44233577 CAGGAGGCAGACAGGGAGGGAGG - Exonic
1008385109 6:50880333-50880355 AAGGGGACAGGAAGGGAGGAGGG - Intergenic
1008502089 6:52193459-52193481 CTGGTAACAGGGAGGGAGGATGG - Intergenic
1009450762 6:63797811-63797833 TAGTGAACAGACAGTGTGGAAGG + Intronic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1010304046 6:74296457-74296479 GAGGGAACAGACAGTGAAGTGGG - Intergenic
1010913792 6:81590568-81590590 CAGGGAAGAATCAGGGAAGAAGG + Intronic
1011217598 6:85021329-85021351 CATGGAAGAGTAAGGGAGGAAGG + Intergenic
1011600637 6:89056952-89056974 GAGGGAGCAGACAGGAAGCAAGG - Intergenic
1011853160 6:91655494-91655516 CAGGGACCAGTCAGAGAAGAGGG - Intergenic
1011871535 6:91900412-91900434 CAGGGAACATCCAGGTAAGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012988867 6:105904460-105904482 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013627774 6:111954653-111954675 CAGGGAGCTCACAGAGAGGATGG - Intergenic
1013685994 6:112583771-112583793 CAGGGAAAAAACTGGGAGGTGGG - Intergenic
1014028382 6:116674275-116674297 GAGAGAACAGACAGGAATGAAGG + Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014268232 6:119306418-119306440 CATGGAAGAGAAAGTGAGGATGG - Intronic
1014756053 6:125302551-125302573 GAGGGAACAGCCAGTGAGGTAGG + Intergenic
1014964858 6:127735178-127735200 CAAGGAATAGACAGGGACTAAGG + Intronic
1015017525 6:128432008-128432030 GAGGGAAGAGAAAGGAAGGAAGG + Intronic
1015074142 6:129134540-129134562 CATGGAATTGACAGGGGGGATGG + Intronic
1015823183 6:137284334-137284356 GTGGGAGGAGACAGGGAGGAAGG + Intergenic
1016532545 6:145074939-145074961 AAAGGAAGAGAGAGGGAGGAAGG + Intergenic
1017960799 6:159218851-159218873 CAGGGAGCTGAGAGGGAGCAAGG + Intronic
1018072590 6:160178653-160178675 AAGGGAAAAGACAGGGAGAGAGG - Intronic
1018147021 6:160900798-160900820 CAGGGTACTGAGAGGGAGCATGG + Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018581898 6:165315142-165315164 GAGAGAACAGAGAGGCAGGAGGG - Intergenic
1018862268 6:167719845-167719867 CAGGCGACAGGCAGGAAGGACGG - Intergenic
1018949576 6:168370533-168370555 CCGGGCACAGACAAGGAGAAGGG - Intergenic
1019049218 6:169170331-169170353 CAGGGAATGGCAAGGGAGGAGGG - Intergenic
1019266782 7:121583-121605 GGCGGAAAAGACAGGGAGGAGGG + Intergenic
1019320821 7:414512-414534 AAGGGAAGAGAAGGGGAGGAGGG - Intergenic
1019381060 7:723814-723836 CAGGTAGCAAACAGGGAGGGAGG - Intronic
1019444999 7:1066608-1066630 CCGTGGACAGACAGGTAGGAGGG - Intronic
1019479769 7:1261178-1261200 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479777 7:1261201-1261223 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479785 7:1261224-1261246 CAGGGGACGGACAGGGAGGATGG + Intergenic
1019479808 7:1261288-1261310 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479816 7:1261311-1261333 CAGGGGATGGACTGGGAGGATGG + Intergenic
1019479830 7:1261353-1261375 CAGAGGACGGACTGGGAGGATGG + Intergenic
1019479838 7:1261376-1261398 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479863 7:1261445-1261467 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479871 7:1261468-1261490 CAGGGGATGGACTGGGAGGATGG + Intergenic
1019479886 7:1261510-1261532 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479894 7:1261533-1261555 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479902 7:1261556-1261578 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479918 7:1261602-1261624 CAGGGGACGGACTGGGAGGATGG + Intergenic
1019479926 7:1261625-1261647 CAGGGGATGGACTGGGAGGATGG + Intergenic
1019484890 7:1284916-1284938 CAGGGGACAAGCAGGGAGAAGGG + Intergenic
1019839512 7:3426248-3426270 GAAGGAACAGACTGGCAGGAAGG + Intronic
1019932571 7:4233771-4233793 CAGGGAGCAGCCCAGGAGGATGG - Intronic
1020029133 7:4920674-4920696 GAGGGAGGAGAGAGGGAGGAGGG - Intronic
1020222414 7:6250017-6250039 CAGGGAAGAGACTGGGATGGGGG - Intronic
1020682887 7:11258607-11258629 CAGAGAACAGTCATGCAGGATGG + Intergenic
1020791895 7:12637472-12637494 AAGAGAAAAGACAGGGAGAAAGG + Intronic
1022207047 7:28174937-28174959 CAGGGCACAGGCAGAGAGCAGGG + Intronic
1022335426 7:29417257-29417279 AAAGGAAGAGAGAGGGAGGAAGG + Intronic
1022624790 7:32024201-32024223 AAGGGAGGAAACAGGGAGGAAGG + Intronic
1023393521 7:39732382-39732404 AAGAGAACATACAGAGAGGATGG + Intergenic
1023484682 7:40673182-40673204 AAGATAACAGACATGGAGGATGG - Intronic
1023619502 7:42055467-42055489 CAGCTAGCAGAGAGGGAGGAGGG - Intronic
1023741879 7:43288309-43288331 CCGGGAGCAGGGAGGGAGGAAGG + Intronic
1023965994 7:44963272-44963294 CAGGGCCCCGAGAGGGAGGAGGG - Intronic
1024094221 7:45971687-45971709 CAGGGAGCAGGGAGGGAGGCAGG - Intergenic
1024317255 7:48032906-48032928 CAGAGACCAGGCAGGAAGGAAGG + Intergenic
1024575941 7:50764186-50764208 CAGGGACAGGACAGGGTGGATGG - Intronic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1025079313 7:55968167-55968189 ATGGGGGCAGACAGGGAGGAGGG - Intronic
1025198843 7:56949844-56949866 TAGGGAGGAGAAAGGGAGGAGGG - Intergenic
1025673103 7:63627089-63627111 TAGGGAGGAGAAAGGGAGGAGGG + Intergenic
1026456257 7:70575166-70575188 CAGTGAACAGATGGGGAAGATGG - Intronic
1026529557 7:71185154-71185176 GAGGGGACAGAGAGGAAGGAAGG - Intronic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1026955235 7:74372634-74372656 CAGGGGCCAGCGAGGGAGGATGG + Intronic
1027224337 7:76234540-76234562 CTGGGAGCAGACTGGGAGGTAGG + Intronic
1027989800 7:85343505-85343527 CAGGAATCAGACAGGGAACAAGG + Intergenic
1029165271 7:98584841-98584863 GAGGGAAGAGAAAGGAAGGAAGG - Intergenic
1029443880 7:100602491-100602513 CAGGGCGCAGGCAGTGAGGAGGG - Exonic
1029487981 7:100854695-100854717 GATGGCACAGACAGAGAGGACGG - Exonic
1029490642 7:100868244-100868266 CAGGGTGCTGACGGGGAGGAGGG - Intronic
1029540380 7:101179288-101179310 CAGGGGACAGGCAGGGAAGCCGG + Intronic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1029597542 7:101545683-101545705 CAGGGAACAGCTTGGGAGCAAGG + Intronic
1029875047 7:103741676-103741698 AAGGGAAAAGACAGGGAGGGAGG + Intronic
1030011572 7:105173728-105173750 CAGAGAACAGAAAAGGAGTATGG + Intronic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030441843 7:109596550-109596572 CAGAGTAGAGACAGGGAGAAGGG + Intergenic
1030955317 7:115844692-115844714 CAGGGAACAGTCAGGGCTGTGGG + Intergenic
1031241171 7:119242304-119242326 TAGGAAACAGACTGGGAGCAAGG - Intergenic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1032085238 7:128880292-128880314 CAGGCATCAGAGAGGGAGGCTGG - Intronic
1032284529 7:130530758-130530780 CAGAAGACAGACAGGGTGGAGGG + Intronic
1032285347 7:130535321-130535343 CAGAAGACAGACAGGGTGGAGGG + Intronic
1032286131 7:130539721-130539743 CAGAAGACAGACAGGGTGGAGGG + Intronic
1032387193 7:131533199-131533221 CAGGGAAGGGACGGGGAGGGTGG - Intronic
1032746304 7:134790110-134790132 GAGAGGACAGAGAGGGAGGAAGG + Intronic
1032954655 7:136956792-136956814 CAGGGAACAGGGAGGGGGAATGG + Intronic
1033150864 7:138913962-138913984 GAGGGGACAGAAAAGGAGGAGGG + Intronic
1033240454 7:139674901-139674923 CAGAGAAGAGCCAGGGTGGATGG - Intronic
1033471267 7:141651680-141651702 CAGCTAACAGAGAGGAAGGATGG - Intronic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034451835 7:151141365-151141387 CATGGCATAGACAGGCAGGAAGG - Intronic
1034625164 7:152487154-152487176 AAGGGAAGAGAGAGGAAGGAAGG - Intergenic
1035045567 7:155963273-155963295 CAGGTAAGAGACAGGGTGGAGGG + Exonic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035238697 7:157516491-157516513 CAGGGTGCTGACAGGGAGGGTGG + Intergenic
1035324473 7:158056031-158056053 CAAGAACCAGACAGAGAGGAAGG - Intronic
1035389196 7:158494477-158494499 CAGGAACCAAAGAGGGAGGAGGG + Intronic
1035542849 8:455285-455307 CAGGGACCAGCCAGGTTGGAGGG + Intronic
1035553187 8:545134-545156 CGGGGACCACACTGGGAGGAGGG - Intronic
1035657316 8:1319889-1319911 GAGGGAAGAGACGGGGACGATGG + Intergenic
1036154173 8:6326261-6326283 AAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1036544350 8:9751819-9751841 GCGGGAACAGAAAGGAAGGAAGG + Exonic
1036942569 8:13065612-13065634 CGGGGAAGAGAAATGGAGGATGG + Intergenic
1037507980 8:19551499-19551521 CAGTGAACCGACAGGGAGACAGG - Intronic
1037610066 8:20468614-20468636 GAGAGTACAGACAGAGAGGAGGG - Intergenic
1037814966 8:22107291-22107313 CAGTGAACAGATAGAGAGGTGGG - Exonic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1037912502 8:22752209-22752231 AATGTAACAGACAGGGAGGATGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038650848 8:29401998-29402020 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1039130765 8:34261733-34261755 CAGCAAACAGACAGGGGGCAGGG - Intergenic
1039568162 8:38565581-38565603 CAGGAAGGAGGCAGGGAGGAGGG - Intergenic
1039820656 8:41131311-41131333 CATGAAAGAGACAGGGAGAATGG + Intergenic
1039864195 8:41487114-41487136 CAGAGAAGATACAGGGAAGAAGG + Intergenic
1041255705 8:55978295-55978317 CAGGGATGAGGGAGGGAGGATGG + Intronic
1041910797 8:63086373-63086395 GAAGGAAGAGAGAGGGAGGAAGG - Intergenic
1042109835 8:65368858-65368880 CAGAGAACAGGGAGGGGGGAGGG + Intergenic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1042849050 8:73197677-73197699 CAGGGGGCAGGCAGGGAGCAGGG + Intergenic
1042943013 8:74126470-74126492 CAGGGAACACACAGGAGGGTGGG - Intergenic
1043044639 8:75306306-75306328 CAGGGAACAAATAGGGTGAAAGG - Intergenic
1044119951 8:88382473-88382495 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1044374722 8:91456396-91456418 CAGGGAGCAGACAGAGAGAGAGG + Intergenic
1044818932 8:96143139-96143161 TGGGGAACAGGCAGTGAGGAAGG - Exonic
1044850228 8:96420121-96420143 CAGGTTACAGACAGGGATGGAGG + Intergenic
1044900298 8:96936973-96936995 GAGGGAGGAGAGAGGGAGGAAGG - Intronic
1044923138 8:97186714-97186736 CAGGGAACAGAGAAGTACGAAGG + Intergenic
1045328873 8:101138047-101138069 CATGGAGCAGCAAGGGAGGAAGG - Intergenic
1046074736 8:109302012-109302034 GAGGGTAGAGACAGGGAGAAGGG - Intronic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1046597374 8:116276325-116276347 GAGGGAAGAGATAGGGAGAAGGG + Intergenic
1046782634 8:118232017-118232039 AAGTGAACAGATAGGCAGGATGG - Intronic
1046919390 8:119712035-119712057 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1047297560 8:123584667-123584689 CAGGCATCAGTCAGGGAGGTGGG - Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048206130 8:132416811-132416833 CAGGGTACAGACAGGAAGGCTGG + Intronic
1048445448 8:134489548-134489570 GAGAGAACAGCCAGAGAGGACGG - Intronic
1048473777 8:134725133-134725155 CAGGAAACGGGCAGGAAGGATGG - Intergenic
1049160373 8:141093948-141093970 CGAGGAAAAGACAGGGAGGGAGG + Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049362644 8:142219653-142219675 CAGGAAATGGACAGGCAGGAAGG - Intronic
1049412668 8:142480263-142480285 CAGGCAGCAGGCAGAGAGGATGG + Intronic
1049620184 8:143594627-143594649 CAGGGAGAAGTCAGGGAGGTGGG + Intronic
1049684844 8:143935161-143935183 AGGGGAAGGGACAGGGAGGAAGG + Intronic
1049686478 8:143941256-143941278 CCCGGAACAGCCAGGGAGGTGGG + Intronic
1049699731 8:144004826-144004848 CAAGGCACAGACTGGGAGCAGGG + Intronic
1049813534 8:144587111-144587133 CAGGGAACAATCATGGTGGAAGG - Intronic
1049814411 8:144591505-144591527 CAGGGAACAATCATGGTGGAAGG - Intronic
1050272182 9:3958101-3958123 CAGGGAACTGAGAGAGTGGAAGG - Intronic
1050443607 9:5693832-5693854 CAGTGAAAAGACAGGAAGAAGGG - Intronic
1050813434 9:9778596-9778618 GAGGGGGCAGACAGGGAGCATGG - Intronic
1051247652 9:15127782-15127804 CAGGGAACAGGCAGTGAGGTAGG - Intergenic
1052816767 9:33107755-33107777 AAGGGACCAGGGAGGGAGGAAGG - Intronic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053579693 9:39391640-39391662 CAGGTCTCAGACAGAGAGGAAGG + Intergenic
1053796584 9:41732175-41732197 CAAGGGACATACCGGGAGGATGG - Intergenic
1053844211 9:42219720-42219742 CAGGTCTCAGACAGAGAGGAAGG + Intergenic
1054101280 9:60950449-60950471 CAGGTCTCAGACAGAGAGGAAGG + Intergenic
1054122653 9:61225812-61225834 CAGGTCTCAGACAGAGAGGAAGG + Intergenic
1054585071 9:66956432-66956454 CAGGTCTCAGACAGAGAGGAAGG - Intergenic
1054653517 9:67644265-67644287 CAAGGGACATACCGGGAGGATGG + Intergenic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1056217062 9:84415305-84415327 AAGGGAAATGAAAGGGAGGATGG - Intergenic
1056372513 9:85971464-85971486 TAGGGAACAGTTATGGAGGAGGG - Intronic
1056431443 9:86532370-86532392 AAAGGAACAGGCAGGGAGTAAGG - Intergenic
1057147907 9:92770769-92770791 CAGGGAACAGTGAGGAAGGAGGG - Intergenic
1057164694 9:92916436-92916458 CAGGGCTCAGACAAGCAGGAGGG + Intergenic
1057274702 9:93670174-93670196 CAGGGAGCAGAGGGAGAGGACGG + Intronic
1057383600 9:94589526-94589548 CAGTGAGCAGACATGGAGCATGG - Intronic
1057704982 9:97389729-97389751 GAGGGAACTGAGAGGGTGGAAGG - Intergenic
1057940984 9:99284109-99284131 CATGGAACAGTGAGGGAGGAAGG - Intergenic
1059339200 9:113587910-113587932 CAGGGAGCAGCCAGGAAGGCAGG - Intronic
1059399332 9:114059125-114059147 GAGGGACCAGGCAGGCAGGAAGG - Intergenic
1059859813 9:118447297-118447319 GAGGAAACAGACAGGAGGGATGG - Intergenic
1060000184 9:119951598-119951620 CAGGGGACAGGTAGAGAGGAGGG - Intergenic
1060016913 9:120094666-120094688 CAGGGGACACACAGGGCGGGGGG + Intergenic
1060194691 9:121616131-121616153 CAGGGATCAGGGTGGGAGGAAGG - Intronic
1060273795 9:122166987-122167009 TGGGCACCAGACAGGGAGGATGG - Intronic
1060297759 9:122354932-122354954 CTGGGGATAGACAGAGAGGAGGG - Intergenic
1060774555 9:126363271-126363293 CATGGAACAGCCAGGAAGCAAGG - Intronic
1061577038 9:131513823-131513845 GAGAGAGCAGTCAGGGAGGAAGG - Intronic
1061898924 9:133663035-133663057 CAAGGGCCAGACAAGGAGGAGGG + Intergenic
1061927710 9:133814131-133814153 CTGGGAACAGACATGAAGGCAGG + Intronic
1062081994 9:134629229-134629251 CAGGGAACAGCCAGGGAAGGGGG - Intergenic
1062213591 9:135377505-135377527 CAGGACACAGCCAGGGCGGAGGG + Intergenic
1062328247 9:136023061-136023083 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062328259 9:136023091-136023113 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062441476 9:136571618-136571640 CAGGGAAGGGCCAGGGTGGAGGG - Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062745758 9:138210985-138211007 CAGGGGACAGACAGGCAGAGCGG + Intergenic
1185485910 X:481739-481761 GAGGAAGGAGACAGGGAGGAAGG + Intergenic
1185485952 X:481881-481903 AAGGAAGGAGACAGGGAGGAAGG + Intergenic
1185854211 X:3519177-3519199 CAGGAATCAGACAGGGGGGCGGG + Intergenic
1186179903 X:6963291-6963313 CAGCTAACAGAAAGGGAGGCTGG + Intergenic
1186852705 X:13596324-13596346 CATGGAGCAGTGAGGGAGGAAGG - Intronic
1188004853 X:25010222-25010244 GAGGGAAGAGGGAGGGAGGAGGG - Intronic
1188140960 X:26550435-26550457 GAGGGAAGAGTCTGGGAGGAGGG - Intergenic
1188332149 X:28887505-28887527 AAGGGAACAGACAAAGAGGAGGG - Intronic
1188483270 X:30655381-30655403 CAGGGACCAGGCAGGTAGAAGGG + Intronic
1189417587 X:40828828-40828850 CAGGGAGGAGACAGAGAGGTGGG + Intergenic
1189719386 X:43899740-43899762 CAGGGAACAGTAATGGAGGCTGG + Intergenic
1189845378 X:45131697-45131719 CATGGAAAAGACAGAGAGAAAGG - Intergenic
1189849563 X:45165171-45165193 TAGGGAACAGAAGGGGAGCAAGG + Intronic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1192151448 X:68715198-68715220 AAGGGAACGGCCAGGAAGGAGGG - Intronic
1192331828 X:70181933-70181955 CATGGACCAGACTGAGAGGATGG - Intronic
1192366714 X:70479842-70479864 GAGGGAACAGATAGGTAGCATGG + Intronic
1193145059 X:78067592-78067614 AAGGGGACAGGCAGGGATGAGGG + Intronic
1193247555 X:79246809-79246831 CAAAGAACAGAAAGGAAGGAAGG + Intergenic
1194067316 X:89277290-89277312 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1194806409 X:98333871-98333893 CTGGAAACAGATAGGGATGATGG + Intergenic
1194984744 X:100478261-100478283 AAGGGGACAGAAAGGAAGGAAGG - Intergenic
1195280815 X:103330815-103330837 AAGGATACAGACAGGAAGGAGGG + Intronic
1195789215 X:108563338-108563360 CATGGAACTGACAGCTAGGAAGG + Intronic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196388469 X:115185636-115185658 CAGAGAAAAGATGGGGAGGAGGG - Intronic
1196653298 X:118190524-118190546 AAGGGAAAAGAAAGAGAGGAAGG + Intergenic
1196717190 X:118823456-118823478 TAGGGAAAAGACGGGGAAGAGGG - Intergenic
1199249724 X:145646636-145646658 CATTGAACAGATAGGAAGGACGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199856825 X:151766058-151766080 CAGGGGACAGACTTTGAGGAGGG - Intergenic
1200091954 X:153640143-153640165 CAAGGAAGGGACAGGAAGGACGG + Intergenic
1200102326 X:153694313-153694335 CAGAGCCCAGTCAGGGAGGATGG - Intronic
1200128398 X:153828969-153828991 CCGGGAACTGAGAGGGAAGAAGG + Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200721475 Y:6611504-6611526 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1201163091 Y:11181705-11181727 CAGGGAACAGGCAGGGTGGGCGG + Intergenic
1202070196 Y:20984280-20984302 CATGAAAGAGACAGGGAGAATGG - Intergenic