ID: 1002952242

View in Genome Browser
Species Human (GRCh38)
Location 6:1825505-1825527
Sequence GGGCCCAACAAAATCACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002952242 Original CRISPR GGGCCCAACAAAATCACCTA AGG (reversed) Intronic
903769705 1:25756272-25756294 GGTCCCAACAAAGTGACCTCGGG - Intronic
904756748 1:32772218-32772240 GGCCCCAAAGAAGTCACCTAAGG + Exonic
906200838 1:43959196-43959218 GGGGCCCATAAAATCACTTAAGG - Intronic
910288985 1:85581736-85581758 GGGCCCAACGAAAGCGCATACGG + Intronic
910477461 1:87622358-87622380 GAACTCAACACAATCACCTAAGG - Intergenic
912426466 1:109596859-109596881 GGCTACATCAAAATCACCTAAGG - Exonic
915163623 1:153936073-153936095 GTGCCCAACACCATCACCTATGG - Exonic
918290844 1:183106594-183106616 CTGCACAACAAAATCACCTTTGG - Intronic
918338272 1:183543916-183543938 GGGCCAAAATAACTCACCTATGG + Intronic
918868439 1:189934605-189934627 TGGCCATACAAAATCACATAGGG - Intergenic
922122819 1:222690135-222690157 TCACACAACAAAATCACCTAAGG + Intronic
1064220861 10:13439481-13439503 GGGCCCACCACAAGCACCTGTGG + Exonic
1069058112 10:63865760-63865782 GTGCACATCAGAATCACCTAAGG + Intergenic
1071778328 10:88814035-88814057 AGGCCTAACCATATCACCTAGGG + Intronic
1072880933 10:99228870-99228892 GGGAACAACAAAATCACATCGGG + Intronic
1075529784 10:123219506-123219528 GGGTCCAACAAGATCACCCTTGG + Intergenic
1075590483 10:123687683-123687705 GGGCTCAGCAAAACCACATATGG + Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1082911953 11:58387086-58387108 GGGCCCAACCAAAGCAACGATGG + Intergenic
1086615024 11:88806150-88806172 GTGCTCACCAAAATCATCTATGG + Intronic
1087501389 11:98958895-98958917 GAGCCAAACCATATCACCTATGG + Intergenic
1099170664 12:79359947-79359969 AACCCCATCAAAATCACCTAGGG + Intronic
1099176904 12:79432544-79432566 AGGCTCAACAAAGTCACTTAAGG + Intronic
1112227162 13:97551112-97551134 GAGCCAAACCATATCACCTATGG - Intergenic
1114338407 14:21716609-21716631 GGGGCCATGAAAACCACCTACGG + Intergenic
1117346351 14:54836680-54836702 GTGCCTATCCAAATCACCTAGGG - Intergenic
1122855391 14:104557522-104557544 GGGACCCACAAAATCACTCATGG + Intronic
1124078647 15:26470574-26470596 TGGCCAAACAAAATTACCCAAGG - Intergenic
1128692689 15:69737269-69737291 GGACCCAACATAATCACATGGGG + Intergenic
1130901311 15:88208765-88208787 CTGCACATCAAAATCACCTAGGG + Intronic
1130937901 15:88485587-88485609 GGGCCCCACAGAATCAGCCAAGG - Intergenic
1132093949 15:98968334-98968356 TAGCCCAACAAAATCACAAAGGG - Exonic
1132151654 15:99466481-99466503 GAGGCCAACAAAATAAACTATGG + Intergenic
1134385914 16:13772268-13772290 TCCCACAACAAAATCACCTAGGG + Intergenic
1144744465 17:17604462-17604484 GGGCCCAAAACAAGCACATATGG + Intergenic
1156840292 18:41603024-41603046 AGGTGCATCAAAATCACCTAGGG + Intergenic
1160546959 18:79664452-79664474 GAGCCAAACCATATCACCTAGGG + Intergenic
1164691906 19:30217569-30217591 GGGCCCTACAAAATCCCCCAGGG - Intergenic
925340817 2:3134404-3134426 GTGCTCAACATAATCACCGATGG + Intergenic
927315060 2:21672068-21672090 GGGGCCAACAGAAGCACCCAAGG + Intergenic
932568242 2:72923009-72923031 GGCCCTGACAAAATCACCCATGG - Intronic
937117152 2:119415976-119415998 GTGCACATTAAAATCACCTAGGG + Intergenic
937730581 2:125224351-125224373 GGGCCCAAAAAACTGCCCTATGG - Intergenic
946467253 2:219922880-219922902 GGCCACACCAAAATCACCTGGGG + Intergenic
946894062 2:224305252-224305274 TGGCCCAATAAAATCTCCTATGG + Intergenic
1174032609 20:47642230-47642252 TGGCCCAACAAGATCATCCAGGG - Exonic
1184157413 22:42677192-42677214 GGGCCAAACCATATCAACTAGGG - Intergenic
950866651 3:16195197-16195219 TGGCACAACTAAATGACCTAGGG - Intronic
950866898 3:16196791-16196813 TGGCACAACTAAATGACCTAGGG + Intronic
953051663 3:39349799-39349821 CGGCCGAACAAAATCTCATAGGG - Intergenic
959890057 3:111544506-111544528 GGGGTTAACAACATCACCTATGG + Intronic
960948178 3:122981272-122981294 GGGCCCAACACAAGCCCCGAGGG - Intronic
967947403 3:194814911-194814933 GGGACCCAGAAAACCACCTAGGG + Intergenic
970498381 4:16651548-16651570 GGGTCCAAGAAAATCAACTGAGG - Intronic
973548582 4:52007506-52007528 GAGCCGAAGAAAATCACTTAAGG + Intronic
978768468 4:112429506-112429528 GTGCACATCAAAATCACCCAAGG + Intronic
981095511 4:140775367-140775389 GGACCCAAAACAATCACCTGAGG + Intergenic
983081280 4:163387913-163387935 GGGACCAGCGCAATCACCTATGG - Intergenic
988838659 5:35061051-35061073 GGGCACAACAAAATGGTCTAAGG - Exonic
989421020 5:41240264-41240286 TGGCCCACCAATAGCACCTATGG - Intronic
994001655 5:94788646-94788668 GGGGCCAACAGAAGCACCTTCGG - Intronic
996951255 5:129128537-129128559 CTGCACAACAAAATCATCTAGGG + Intergenic
998533114 5:142903324-142903346 GTGACTATCAAAATCACCTAGGG - Intronic
1001145917 5:169184578-169184600 ACACACAACAAAATCACCTAGGG + Intronic
1001777674 5:174341100-174341122 GTGCACAATAGAATCACCTATGG + Intergenic
1002323313 5:178388609-178388631 GGGCCCAGCAAAATCACCAGGGG - Intronic
1002952242 6:1825505-1825527 GGGCCCAACAAAATCACCTAAGG - Intronic
1005156017 6:22807416-22807438 GTGCCCTACAAAATACCCTAAGG - Intergenic
1011217357 6:85019134-85019156 GGGCCCACCTAGATCACTTAGGG + Intergenic
1011751154 6:90456240-90456262 AAGCCCAACATAATCACATATGG - Intergenic
1015571444 6:134625354-134625376 CTGCCCATCACAATCACCTAAGG - Intergenic
1027716741 7:81681117-81681139 GGGCACAAGAAAAAGACCTAGGG - Intergenic
1034950978 7:155297315-155297337 GGGCCCGAAAAAATCACCCAAGG + Intergenic
1039599400 8:38821795-38821817 TCACACAACAAAATCACCTAAGG - Intronic
1040400289 8:47043628-47043650 GGACTCAACACAATCACCCAGGG + Intergenic
1045311135 8:101003976-101003998 GGGCACAACAGAATCACTTGGGG + Intergenic
1045383963 8:101653474-101653496 GGGCCCGTCAGAATCACCTGGGG + Intronic
1045456246 8:102382271-102382293 GAGACCAACAGAATCACCTGTGG + Intronic
1046317164 8:112519131-112519153 GAGCCAAACCATATCACCTATGG + Intronic
1047222750 8:122931668-122931690 CTGCCCATCAAGATCACCTAGGG + Intronic
1052841273 9:33292957-33292979 GGGCCTCACAAAATCACAAAAGG - Intronic
1056618786 9:88192870-88192892 GTGCGCATCAAAATCACCCAAGG + Intergenic
1185660544 X:1725332-1725354 GTCCCCAAAAAAATCACCTCTGG - Intergenic
1190969778 X:55337267-55337289 GGATACATCAAAATCACCTAGGG + Intergenic