ID: 1002952375

View in Genome Browser
Species Human (GRCh38)
Location 6:1827003-1827025
Sequence GTTACAGTGAGCTATGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002952374_1002952375 -3 Left 1002952374 6:1826983-1827005 CCTGAGCGTAGGAGTTCAAGGTT 0: 1
1: 9
2: 90
3: 619
4: 2736
Right 1002952375 6:1827003-1827025 GTTACAGTGAGCTATGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002952375 Original CRISPR GTTACAGTGAGCTATGATTG TGG Intronic
No off target data available for this crispr