ID: 1002953344

View in Genome Browser
Species Human (GRCh38)
Location 6:1837883-1837905
Sequence GGGAGCAGACAGGAGGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002953338_1002953344 -10 Left 1002953338 6:1837870-1837892 CCCAGGCCTCACAGGGAGCAGAC 0: 1
1: 1
2: 3
3: 40
4: 388
Right 1002953344 6:1837883-1837905 GGGAGCAGACAGGAGGACTAGGG No data
1002953330_1002953344 25 Left 1002953330 6:1837835-1837857 CCAGCTCAGCATCTACAGCTCAG 0: 1
1: 0
2: 2
3: 21
4: 199
Right 1002953344 6:1837883-1837905 GGGAGCAGACAGGAGGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002953344 Original CRISPR GGGAGCAGACAGGAGGACTA GGG Intronic
No off target data available for this crispr