ID: 1002953344 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:1837883-1837905 |
| Sequence | GGGAGCAGACAGGAGGACTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1002953338_1002953344 | -10 | Left | 1002953338 | 6:1837870-1837892 | CCCAGGCCTCACAGGGAGCAGAC | 0: 1 1: 1 2: 3 3: 40 4: 388 |
||
| Right | 1002953344 | 6:1837883-1837905 | GGGAGCAGACAGGAGGACTAGGG | No data | ||||
| 1002953330_1002953344 | 25 | Left | 1002953330 | 6:1837835-1837857 | CCAGCTCAGCATCTACAGCTCAG | 0: 1 1: 0 2: 2 3: 21 4: 199 |
||
| Right | 1002953344 | 6:1837883-1837905 | GGGAGCAGACAGGAGGACTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1002953344 | Original CRISPR | GGGAGCAGACAGGAGGACTA GGG | Intronic | ||
| No off target data available for this crispr | |||||