ID: 1002956361

View in Genome Browser
Species Human (GRCh38)
Location 6:1869315-1869337
Sequence AAATCAAGGGCGTAAGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002956356_1002956361 18 Left 1002956356 6:1869274-1869296 CCTTTCTTTGTTCCTATTTTTTT 0: 1
1: 6
2: 82
3: 959
4: 8642
Right 1002956361 6:1869315-1869337 AAATCAAGGGCGTAAGTCACAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1002956357_1002956361 6 Left 1002956357 6:1869286-1869308 CCTATTTTTTTAATAGCGTTCCT 0: 1
1: 0
2: 0
3: 24
4: 286
Right 1002956361 6:1869315-1869337 AAATCAAGGGCGTAAGTCACAGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002956361 Original CRISPR AAATCAAGGGCGTAAGTCAC AGG Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
921697267 1:218226125-218226147 AATACAAGTTCGTAAGTCACAGG + Intergenic
922151692 1:223011019-223011041 CAATCAAGAGCTTAATTCACTGG + Intergenic
1074227089 10:111495077-111495099 AAAACAAGGGCCTATGTCAATGG - Intergenic
1078647390 11:13153790-13153812 AAATGATGAGCCTAAGTCACGGG + Intergenic
1085468590 11:76741441-76741463 AAATCTAGGGCGCAAGGCTCTGG + Intergenic
1087107105 11:94421727-94421749 AAATGAAAGGTGTAAGTCACAGG + Intronic
1088657761 11:112016758-112016780 CCATGAAGGGCGTAAGTGACCGG - Intronic
1089741643 11:120588606-120588628 AGGTCAAGGGTGTAAGTCAAAGG + Intronic
1095289392 12:40460103-40460125 AACTCAAGGCAGAAAGTCACTGG + Intronic
1097104458 12:56613131-56613153 CAATCAAGGGCAGAAATCACAGG + Exonic
1111744805 13:92254107-92254129 AAATCAAGGGAGTAAACCAGGGG + Intronic
1115900081 14:38136358-38136380 AAATCAAATGAGTAAGTCACAGG - Intergenic
1117257318 14:53991568-53991590 AAATCAGGGGCGTACTTTACAGG - Intergenic
1125812299 15:42551714-42551736 AAACCAAAGGAGTAAGGCACTGG + Intronic
1126152773 15:45538184-45538206 AAACCAAGAGCCTAAGTCTCAGG - Intergenic
1127046479 15:55031350-55031372 AAATCAAAGTCTAAAGTCACAGG + Intergenic
1128639302 15:69324311-69324333 AAACCAAGGGCAGAAGGCACAGG + Intronic
1130616416 15:85412938-85412960 AAATCAGGGGGCTAAGGCACTGG + Intronic
1132205820 15:99985365-99985387 AAATCAAGTGCACAAGGCACTGG - Intronic
1135282669 16:21166462-21166484 AAATCCAGGCCATCAGTCACAGG + Intronic
1138010842 16:53378417-53378439 AAAACAAGGGCTTAGGTAACAGG + Intergenic
1145175506 17:20697717-20697739 AAAACAAGGGCATCAGTCCCAGG - Intergenic
1147745390 17:42691566-42691588 AAATCTAGGCCGCATGTCACTGG + Intronic
1147912226 17:43862526-43862548 AACTCAAGTGCGACAGTCACTGG - Exonic
1148179521 17:45594129-45594151 AAAATAAGGGAGTAAGTCAAAGG - Intergenic
1148269386 17:46251774-46251796 AAAATAAGGGAGTAAGTCAGAGG + Intergenic
931075601 2:58708020-58708042 AAATAAAGGACTTCAGTCACTGG - Intergenic
933192017 2:79345032-79345054 AAATAAAGTGCATAAGTTACGGG - Intronic
935207925 2:100912712-100912734 CATTCAAGGGCGAATGTCACGGG + Intronic
937576697 2:123431676-123431698 AAATCAAGGAGGTAAGCAACAGG - Intergenic
941604056 2:167574526-167574548 AAATGAAGGGACTAAGTCACAGG + Intergenic
943007824 2:182408111-182408133 TAATCACTGGTGTAAGTCACTGG + Intronic
943672470 2:190678228-190678250 AAATCAAGAGCCAAAGTCCCTGG + Intronic
1169775540 20:9248901-9248923 AAATCAAGGGCTAAAATCAAGGG + Intronic
1171370521 20:24659264-24659286 AAATCATGGCCGGTAGTCACTGG - Intronic
1178927046 21:36785021-36785043 AAATCAAGGGCCCAAGTGGCCGG - Intronic
952688871 3:36180264-36180286 GAATCAAGTGCGTAGGACACAGG + Intergenic
955510880 3:59679225-59679247 AGATCAAGGGCTCAAGTCAACGG + Intergenic
955902032 3:63766716-63766738 AAATACAGGGCTGAAGTCACTGG + Intergenic
960425340 3:117500131-117500153 AAATCACTGGCCTAAGTCAATGG + Intergenic
963183295 3:142383919-142383941 AATTCAAGGGTGTAAGTTAATGG + Intronic
963873299 3:150443387-150443409 AGTTCATGGCCGTAAGTCACTGG + Intronic
964821355 3:160773842-160773864 AAACCAAGGGGGTGAGTCTCTGG - Intronic
971226136 4:24753010-24753032 GCATCAAGGGTATAAGTCACTGG - Intergenic
976092604 4:81473320-81473342 ATGTCAAGGGTGTAAGTGACTGG - Intronic
978426172 4:108584880-108584902 AAATAAAGGGCTAAAGTCATTGG + Intergenic
985346434 4:189010292-189010314 GATTCAAGGTCATAAGTCACAGG - Intergenic
986148737 5:5107051-5107073 AAATCACGGGAGTAAGGCCCAGG - Intergenic
986525695 5:8672633-8672655 AAATCAAGGACGTATTTCAAAGG + Intergenic
993938519 5:94031613-94031635 AAACCAAGGGTGTAGCTCACAGG + Intronic
997104219 5:131000125-131000147 CAATCAAAGATGTAAGTCACTGG + Intergenic
998507338 5:142682543-142682565 AAACCAAGGGCCAAAGTCACAGG + Intronic
1002956361 6:1869315-1869337 AAATCAAGGGCGTAAGTCACAGG + Intronic
1004549250 6:16630393-16630415 AATTCAAGGGCCTAAGTGAGTGG + Intronic
1004835950 6:19531721-19531743 AAGTCAATGGTGTAAGTCAATGG - Intergenic
1004928282 6:20436723-20436745 AATTCAAGGGCTTAAATCCCAGG - Intronic
1010763780 6:79755369-79755391 AACTCGAGGGCCTCAGTCACAGG - Intergenic
1016249513 6:142022955-142022977 AAATAAAAAGTGTAAGTCACAGG - Intergenic
1021415533 7:20379204-20379226 AAATCCAAGACGAAAGTCACGGG - Exonic
1026058658 7:67007078-67007100 AATTCAAGGACGTCAGCCACAGG - Intronic
1031574627 7:123400430-123400452 AAACCTAAGGCCTAAGTCACTGG - Intergenic
1034140603 7:148812024-148812046 AAATCAAGGGCTGAAGATACAGG - Intronic
1036761999 8:11515638-11515660 AAATTAAGGAGGTAAGTGACTGG - Intronic
1045760614 8:105602089-105602111 AAGTCAAGGGCATAACTCACTGG - Intronic
1047632554 8:126724269-126724291 AAATCAAAGTCGTGAGGCACCGG + Intergenic
1061358792 9:130127170-130127192 AAATCAAGGGCTTATGTCTGTGG + Intronic
1061630695 9:131870485-131870507 AAGTCAGGGGGCTAAGTCACAGG + Intronic
1191741225 X:64437349-64437371 CAATCTAGGGGGTAAGTGACAGG + Intergenic
1192794590 X:74416130-74416152 TAATCAAGGGCATAAGTAATTGG + Intergenic
1194578220 X:95639598-95639620 AAATGCAGGTCGTAAGTCATGGG - Intergenic
1199661388 X:150053941-150053963 GAGGGAAGGGCGTAAGTCACAGG - Intergenic