ID: 1002956361

View in Genome Browser
Species Human (GRCh38)
Location 6:1869315-1869337
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002956357_1002956361 6 Left 1002956357 6:1869286-1869308 CCTATTTTTTTAATAGCGTTCCT 0: 1
1: 0
2: 0
3: 24
4: 286
Right 1002956361 6:1869315-1869337 AAATCAAGGGCGTAAGTCACAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1002956356_1002956361 18 Left 1002956356 6:1869274-1869296 CCTTTCTTTGTTCCTATTTTTTT 0: 1
1: 6
2: 82
3: 959
4: 8642
Right 1002956361 6:1869315-1869337 AAATCAAGGGCGTAAGTCACAGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type