ID: 1002957126

View in Genome Browser
Species Human (GRCh38)
Location 6:1877147-1877169
Sequence CTGTGCCTCTGGCTGTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002957126_1002957132 27 Left 1002957126 6:1877147-1877169 CCATCTAACAGCCAGAGGCACAG 0: 1
1: 0
2: 0
3: 22
4: 299
Right 1002957132 6:1877197-1877219 ATGTTCAGTTGAACCACTGGTGG 0: 1
1: 0
2: 1
3: 8
4: 100
1002957126_1002957131 24 Left 1002957126 6:1877147-1877169 CCATCTAACAGCCAGAGGCACAG 0: 1
1: 0
2: 0
3: 22
4: 299
Right 1002957131 6:1877194-1877216 CAGATGTTCAGTTGAACCACTGG 0: 1
1: 0
2: 3
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002957126 Original CRISPR CTGTGCCTCTGGCTGTTAGA TGG (reversed) Intronic
902199982 1:14826163-14826185 CTGTGCCTCTGTCCCTCAGATGG - Intronic
902471064 1:16647775-16647797 CTGTGCCTCGGACCCTTAGATGG - Intergenic
902487740 1:16759673-16759695 CTGTGCCTCGGACCCTTAGATGG + Intronic
903385777 1:22925206-22925228 CAGTGCCTCTGGCTGAAAGTGGG - Intergenic
903911694 1:26731450-26731472 CTGAGCCTGTGGCTGTGAGTAGG - Exonic
904374089 1:30068846-30068868 TTATGCCTCTGGCAGTGAGAAGG + Intergenic
905241573 1:36584791-36584813 CTGTCCCTCTGGGCGTAAGAAGG + Intergenic
905246362 1:36617087-36617109 CTGTGTCTATGGGTGTGAGACGG + Intergenic
905954103 1:41977745-41977767 TTGTGCCTTTGGGTGTTGGAAGG - Intronic
906199519 1:43950129-43950151 CTGGGCATCAGGCTGTGAGATGG - Exonic
907833124 1:58084351-58084373 CTGGGCCTGTGGGTGTTAGGGGG + Intronic
909078465 1:71081180-71081202 CTGTGCTACTGTTTGTTAGATGG + Exonic
909156239 1:72080948-72080970 ATGTGCCTCTGGTTGAGAGAGGG + Intronic
910618216 1:89223977-89223999 CTGTGACTCTGCCTGGTTGAGGG - Intergenic
910659495 1:89656050-89656072 TTGTACCTCTCGCTGTAAGATGG - Intronic
910815918 1:91290304-91290326 GTGTGTCTCTGCCTGTGAGATGG - Intronic
911256974 1:95644436-95644458 CTCTGCCTCTTGCTGTCACATGG + Intergenic
911423861 1:97681246-97681268 TTGTGCCTCTTGAGGTTAGAGGG + Intronic
911504236 1:98728553-98728575 GTGTGTCTCTGCCTGTGAGATGG - Intronic
911516971 1:98879481-98879503 GTGTGTCTCTGGATGTGAGATGG + Intergenic
912751296 1:112290228-112290250 CTGTGTCTCTGCATGTGAGATGG - Intergenic
912774040 1:112492559-112492581 CTGTGCTTCTGGCTGGGGGAAGG + Intronic
913158735 1:116126529-116126551 CTGAGCCTCAGTCTCTTAGATGG - Intronic
913455149 1:119022739-119022761 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
913571521 1:120124979-120125001 CTCTTCCTCTTGCTGTTAGATGG - Intergenic
914292442 1:146286600-146286622 CTCTTCCTCTTGCTGTTAGATGG - Intergenic
914553486 1:148737383-148737405 CTCTTCCTCTTGCTGTTAGATGG - Intergenic
917712018 1:177694757-177694779 CTGTGTCTCTGCATGTGAGATGG - Intergenic
920294993 1:204950596-204950618 CTGTGCCTCTGGGAGTTGGGAGG + Intronic
920774609 1:208923964-208923986 ATTTTCCTCTGGGTGTTAGACGG + Intergenic
920942422 1:210496247-210496269 CTATGCCTGTGGCTGTTGGCAGG + Intronic
921699512 1:218251777-218251799 CTTTGCCTCTGGATGTTCCAAGG - Intergenic
921804497 1:219438105-219438127 CTATGCCTCTTGCTATAAGAGGG - Intergenic
922205260 1:223440877-223440899 CTCTCTCTCTGGCTTTTAGATGG + Intergenic
922826471 1:228524577-228524599 GTGTGTCTCTGCCTGTGAGATGG + Intergenic
923350616 1:233101676-233101698 CTTTGCTTCTGACTGTTACAGGG - Intronic
923599032 1:235385705-235385727 GTGTGTCTCTGCCTGTGAGATGG + Intronic
924172741 1:241358121-241358143 CTGTGCCTCTGGCTTTCAGGGGG + Intergenic
1062783977 10:245404-245426 CTGGGCCTATGACTGTTGGAAGG - Intronic
1062944270 10:1448860-1448882 CTGAGGCTCTGGCTGTTGGTGGG - Intronic
1063239576 10:4153924-4153946 CTGTGCCCCTGGCTGCCAGGGGG - Intergenic
1065484312 10:26222234-26222256 TTGTGCCTCTGGATATCAGAAGG - Intronic
1066755426 10:38707095-38707117 GTGTGTCTCTGCATGTTAGATGG - Intergenic
1067063668 10:43091112-43091134 CTGTGCATCTGGTTTTTATAGGG - Intronic
1067792370 10:49298084-49298106 CTGTGGCCCTGGCTGTCAGCCGG + Intergenic
1068512411 10:57983547-57983569 CTGTGCCTCTTTCTTTTTGATGG + Intergenic
1073187086 10:101621740-101621762 CTGTGCCTCTTGCTGTGATCTGG - Intronic
1076099502 10:127764410-127764432 ACATGCCTCTAGCTGTTAGAAGG + Intergenic
1076610697 10:131724215-131724237 CTGTGCCTGTGTCTGTTTGTGGG - Intergenic
1076929901 10:133525177-133525199 CTGTGCCTCTGCCCGTGACAAGG - Intronic
1076929908 10:133525225-133525247 CTGTGCCTCTGTCCGTGACAAGG - Intronic
1076929926 10:133525357-133525379 CTGTGCCTCTGCCCGTGACAAGG - Intronic
1077506308 11:2931411-2931433 CTGTGCCCCTGGGGTTTAGAGGG - Intergenic
1080596765 11:33780046-33780068 CTGTGCCTCTTGCTTTTTCAGGG + Intergenic
1083498097 11:63076841-63076863 GTGTGTCTCTGCCTGTGAGATGG + Intergenic
1086853365 11:91837918-91837940 CTTTTGCTCTGGATGTTAGAGGG - Intergenic
1086904988 11:92408122-92408144 CTCTCCTTCTGGCTGCTAGATGG + Intronic
1087668032 11:101072581-101072603 TTGTGTCTCTGCCTGTGAGATGG - Intronic
1088957834 11:114627773-114627795 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
1088958613 11:114637351-114637373 GTGTGTCTCTGCCTGTGAGATGG + Intergenic
1088964349 11:114702933-114702955 CTGTGGCTCTGGCTCTGAAAGGG + Intronic
1088978906 11:114843361-114843383 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
1088985875 11:114907806-114907828 CTCTGCTTCTGGGGGTTAGATGG + Intergenic
1089167221 11:116486456-116486478 CTGGGCCTCTGGCTGGGAGAGGG - Intergenic
1093782065 12:23148084-23148106 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1094875856 12:34641768-34641790 GTGTGTCTCTGCCTGTGAGACGG - Intergenic
1095998229 12:48107080-48107102 CTGTGCCTGTGGCTGTGATCTGG - Intronic
1106827621 13:33541648-33541670 CTTTCCCTCTGGCTTTTACAAGG + Intergenic
1107061604 13:36165607-36165629 CTGTGCATCTCCCTGTTACATGG - Intergenic
1109729507 13:66393330-66393352 CTGTGCCTATGGTTGTTTGCAGG - Intronic
1111765090 13:92517612-92517634 CTGAGGGTCTGACTGTTAGAAGG + Intronic
1113925926 13:113941650-113941672 CTGTTTCTCTGCCTGTCAGATGG + Intergenic
1114195895 14:20475836-20475858 CTGTACCTCTAGCTGGAAGATGG + Intronic
1114405938 14:22456109-22456131 CAGTGCCTTTGTCTGTGAGATGG + Intergenic
1114704604 14:24712736-24712758 CTCATCCTCTTGCTGTTAGAAGG + Intergenic
1114749368 14:25185654-25185676 GTGTGCCTCTGCATGTGAGATGG - Intergenic
1114807555 14:25855804-25855826 GTGTGTCTCTGCATGTTAGATGG + Intergenic
1115269821 14:31539436-31539458 CTGTGCCTCTGGCTCCTTGCTGG + Intronic
1115843872 14:37503860-37503882 TTGTGCCTCTGCATGTAAGATGG - Intronic
1116165479 14:41329607-41329629 CTGGGGGTCTGACTGTTAGAAGG - Intergenic
1117710952 14:58527960-58527982 CTGTGCCTTTGCATGTGAGATGG - Intronic
1117856574 14:60040647-60040669 GTGTGTCTCTGCCTGTGAGATGG + Intronic
1118461752 14:65993633-65993655 CGGTGCTTCAGGCTGTGAGATGG - Intronic
1118597396 14:67446510-67446532 CTGTGCTCCTGGTAGTTAGAAGG + Intergenic
1121420776 14:93812129-93812151 CTGTGTCTCTGGCTCATAGTAGG - Intergenic
1121530288 14:94647973-94647995 CTGTGACTTTGGCTGTCAGCTGG + Intergenic
1122028071 14:98892152-98892174 CTGTCTCCCTGGCTGGTAGAGGG - Intergenic
1122458610 14:101877389-101877411 CTGTGCCTCTGGGTGTGCGCTGG + Intronic
1122479677 14:102038856-102038878 CTGGACCTGTGGCTTTTAGATGG + Intronic
1122605353 14:102944458-102944480 CCGTGCCGCTGACTGTAAGAAGG - Exonic
1125228956 15:37429267-37429289 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
1126301047 15:47196351-47196373 CTGAGCCACTGTCTGATAGAAGG + Intronic
1126730317 15:51675559-51675581 CTTGGCCTCTGGCTGCTGGAAGG - Intergenic
1126823339 15:52526693-52526715 ATGTTCCTCAGGCTGTTAAAAGG + Intronic
1127193936 15:56563650-56563672 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1127261587 15:57330476-57330498 CTGTCCCTATGGCTGTCAGTGGG + Intergenic
1127343567 15:58070578-58070600 CTTTTCTTCTGGATGTTAGAAGG - Intronic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1127619297 15:60717501-60717523 CTATGGCACTGGCAGTTAGAAGG + Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1128339620 15:66811875-66811897 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1129319229 15:74764705-74764727 CTGGCCCTCTGGCTCCTAGACGG + Intergenic
1130404304 15:83584197-83584219 CTGTGCCGCTGGCTGTGAAGAGG - Intronic
1130475986 15:84267988-84268010 GTGTGTCTCTGCATGTTAGATGG + Intergenic
1130483407 15:84382042-84382064 GTGTGTCTCTGCATGTTAGATGG + Intergenic
1130520765 15:84658946-84658968 CTGTGATGCTGGCTGTGAGAGGG - Intergenic
1132317368 15:100899782-100899804 CTGTGCCCTTGGCTTTGAGAAGG - Intronic
1134205839 16:12237322-12237344 CTGTGCCTCTGTCTGGGAGTGGG + Intronic
1134916036 16:18071968-18071990 CTGAGCCTCTGCCTGTGGGAAGG - Intergenic
1135854542 16:25995123-25995145 CTATTCCTCTGGCTGATAAATGG + Intronic
1137074578 16:35945940-35945962 CTGTGTCTCTGCATGTGAGATGG - Intergenic
1137075595 16:35957246-35957268 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1138734247 16:59231896-59231918 GTGTGCCTCTGCATGTGAGATGG - Intergenic
1139436707 16:66940749-66940771 CAGAGCCTCTGTCTGTTAAACGG + Intronic
1139815949 16:69672062-69672084 CTTTACCTCTGGCTGCTAGGAGG - Intronic
1140120048 16:72075649-72075671 CTTTGCCTCTGGTTCTGAGACGG - Intronic
1144099510 17:11931432-11931454 CTGAGACTCTGACTGTTACATGG - Intronic
1150157831 17:62869017-62869039 CTGTGCCTGTGGCTGCTGGTGGG - Intergenic
1151702847 17:75752538-75752560 CTGGGCCTCTGGCTGCCCGATGG - Exonic
1151891118 17:76950868-76950890 CTGTGCCTCTCGCTGTAAAATGG - Intergenic
1152877692 17:82796551-82796573 CTGTTCCTCTGTCTGTAAAATGG - Intronic
1155498587 18:26465625-26465647 GTGTGCTTCTGTCTGTAAGATGG - Intronic
1155742311 18:29303788-29303810 CTCTGCCTCAGGCATTTAGAAGG + Intergenic
1155915666 18:31554671-31554693 TGCTGCCTCTGGCTTTTAGATGG + Intergenic
1156622328 18:38867205-38867227 CTGTGCCTCATGCTGCTGGAAGG - Intergenic
1157151273 18:45221161-45221183 CTGTACCCCTGGCAGTTAGATGG - Intronic
1163597322 19:18227668-18227690 CTGGGCCTCTGCCTGTGACATGG - Intronic
1164111050 19:22159413-22159435 GTGTGTCTCTGGATGTGAGATGG + Intergenic
1164395008 19:27854932-27854954 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
1165076602 19:33282970-33282992 CTGCGCCTCTGGCTTTAGGAAGG - Intergenic
1166831902 19:45644356-45644378 CTGTCATTCTGGCTCTTAGAGGG + Intronic
1166891517 19:45996885-45996907 CTCTGCCTCTCACTGTTAGGGGG + Intronic
1202703459 1_KI270713v1_random:4566-4588 CTGTGCCTCGGACCCTTAGATGG - Intergenic
926975751 2:18515182-18515204 GTCTCCCTCTGGGTGTTAGAGGG + Intergenic
928695030 2:33840734-33840756 CTTTGACTCGGGCTGTGAGAAGG + Intergenic
930105750 2:47638024-47638046 GTGTCTCTCTGGCTGTTGGATGG - Intergenic
931985971 2:67742853-67742875 CTGTGTCTCTGCATGTGAGATGG + Intergenic
932520433 2:72405956-72405978 CTGTGTCTCTGCCTGTGAGATGG - Intronic
935249555 2:101249694-101249716 CTATGCCACTGGTTGTTAGAAGG - Intronic
936468000 2:112770960-112770982 GTGTCCCTGTGGCTGTGAGAAGG + Intergenic
937127478 2:119483602-119483624 CTGTGCTTTTGGCTGGTACATGG + Intronic
937633103 2:124125166-124125188 ATGTGCCTCTGCATGTGAGAGGG - Intronic
937877529 2:126836836-126836858 CGGTGCCTCTGGCTGTGGGCAGG - Intergenic
938654924 2:133421596-133421618 CTGTGCCTGTGGCTTGGAGATGG - Intronic
939157460 2:138542623-138542645 GTGTGTCTCTGCCTGTGAGATGG + Intronic
939938984 2:148326724-148326746 GTGTGTCTCTGCCTGTGAGATGG + Intronic
941611427 2:167666838-167666860 GTGTGTCTCTGCCTGTGAGATGG + Intergenic
941851977 2:170192203-170192225 CTGAGCCTGTGGCTTTTTGAGGG + Intronic
942702948 2:178734054-178734076 CTATGCCTCTGTCTCTTGGATGG - Intronic
942765153 2:179446532-179446554 GTGTGCCTCTAGCTGTGACAGGG + Exonic
942879199 2:180838874-180838896 CTGAGGGTCTGTCTGTTAGAAGG - Intergenic
944297014 2:198077069-198077091 CTCTGCCTCTGCCTGTTATTCGG + Intronic
947056463 2:226109494-226109516 GTGTGTCTCTGCATGTTAGATGG - Intergenic
947394510 2:229673881-229673903 CTTTGACTCTGGCTGCTAGATGG + Intronic
1170102110 20:12713337-12713359 ATGTTCCTCTGGCTGTGAGAGGG - Intergenic
1170351631 20:15447861-15447883 CTGTCTCTCAGGCTATTAGAAGG + Intronic
1170931265 20:20771276-20771298 CTGTGCCTCTGGCCTGTAGCGGG - Intergenic
1171155887 20:22873469-22873491 GTGTGTCTCTGCCTGTGAGATGG + Intergenic
1172325727 20:34032992-34033014 CTGGGCCTCTGCCTGCTTGAAGG - Intronic
1173801809 20:45898832-45898854 CTGTGGCACTGGGGGTTAGAGGG + Exonic
1174402666 20:50284275-50284297 CTGCTCCCCTGGCTGTTGGAGGG + Intergenic
1174925305 20:54752752-54752774 GTGTGTCTCTGCCTGTGAGATGG + Intergenic
1179016186 21:37595967-37595989 CACTGCCTCTGGGTGTGAGAGGG + Intergenic
1180190681 21:46161130-46161152 CTTTACCTCTGGCTCTTTGAGGG - Intronic
1181845320 22:25703086-25703108 CTGTTCCTTGGGCTGTTTGAGGG + Intronic
1182996652 22:34819028-34819050 GTGTGCCTCTGCATGTGAGATGG - Intergenic
1185411879 22:50686946-50686968 CTGTGCCTCTCTCTGGTATATGG + Intergenic
949598341 3:5572021-5572043 CTGTGCAAGAGGCTGTTAGAAGG + Intergenic
949632346 3:5942437-5942459 ATGTGTCTCTGCCTGTGAGATGG + Intergenic
950101510 3:10359735-10359757 CTGTGGCTCTGGGTGCTAGACGG + Intronic
950677513 3:14563605-14563627 CCATCCCTCTGGCTGCTAGAGGG + Intergenic
950723599 3:14901511-14901533 GTGTGACTCTGTCTGCTAGAGGG + Intronic
950825954 3:15821629-15821651 ATGTTCCTCTGGTTGTTATAAGG - Intronic
951167483 3:19500043-19500065 GTGTGTCTCTGCCTGTGAGATGG - Intronic
952247874 3:31616253-31616275 CTTTTCCTCTGGGTGTTAGAAGG + Intronic
953591423 3:44259109-44259131 CTGTTCTTCTGGTTGTTAGTAGG + Intronic
954298371 3:49686468-49686490 CTGTGCCTCGGACCCTTAGATGG + Exonic
954436686 3:50500044-50500066 CTGTGGCTCTCCCTGTTGGAGGG - Intronic
955637456 3:61045236-61045258 GTGTGTCTCTGCATGTTAGATGG - Intronic
956274573 3:67484154-67484176 CATTGCCTCTGGCTGCTGGATGG + Intronic
957931208 3:86880477-86880499 CTGAGCCTCTCACTGTTTGATGG + Intergenic
958079538 3:88728660-88728682 CTGTGCATCTGGCTGACAGATGG + Intergenic
959409558 3:106003605-106003627 CTGTCCATCTGGATGTCAGATGG - Intergenic
959723749 3:109521335-109521357 CTGTGTCTCTGCATGTGAGATGG + Intergenic
959918708 3:111847568-111847590 CTGTGCATTTGGCCGTGAGAGGG - Intronic
960363663 3:116745092-116745114 CTGTGTCTCTGCATGTGAGATGG - Intronic
960398660 3:117169094-117169116 CTGTGCCTCGGGCCATTAAACGG - Intergenic
960689647 3:120332111-120332133 CTGTGCCTCTGGATTCTAGCTGG + Intronic
961150241 3:124631771-124631793 CTATGCCTCTGGCTTTTACCTGG - Intronic
961386970 3:126528249-126528271 CTCTTCCTATGGCTGTCAGAGGG + Intronic
961570900 3:127798114-127798136 CTGTGTCTTTGACTGTTAGTAGG - Intronic
962418912 3:135210005-135210027 CTGTGCCTCTGGATGGGTGATGG + Intronic
962439489 3:135399753-135399775 GTGTGCCTCTGCATGTGAGATGG + Intergenic
962931388 3:140040861-140040883 GTGTGGATCTGGCTGTTAGGAGG + Intronic
963975900 3:151480548-151480570 CTGTGCCTCTGCTTATAAGATGG - Intergenic
964194323 3:154045181-154045203 CTGTGCCTCTGCCTGATATGAGG + Intergenic
965360839 3:167735690-167735712 CTGCGCCTCTGGCTTCTACAGGG - Intronic
965651439 3:170938143-170938165 CTGAGGGTCTGACTGTTAGAAGG - Intergenic
965749831 3:171964462-171964484 CTGTGCCTTTGTCTGTAAAATGG + Intergenic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
967407859 3:189137600-189137622 CTTTGCCTCTGGCCATTAGAAGG + Intronic
967569694 3:191014431-191014453 GTGTGCCTCTGCATGTGAGATGG + Intergenic
968634545 4:1671224-1671246 CTGTGGCTGTGGCTGTGAGCTGG - Intronic
968634588 4:1671436-1671458 CTGTGGCTGTGGCTGTGAGCTGG - Intronic
968634611 4:1671548-1671570 CTGTGGCTGTGGCTGTGAGCTGG - Intronic
968891465 4:3371643-3371665 CTGTGCCTCTGACTGCGAGAGGG - Intronic
970178883 4:13366870-13366892 CTGTGACTCTAGTTGTTAGTGGG - Intronic
970238544 4:13983633-13983655 CTAAGCCTCTGGCTCTCAGAGGG + Intergenic
971394204 4:26213729-26213751 AGGTGACTCTGGCTGTTGGATGG + Intronic
973034344 4:45387374-45387396 CTGTGCATCTGTCTGGTCGAGGG + Intergenic
976063406 4:81156183-81156205 GTGTGTCTCTGCCTGTGAGATGG - Intronic
976326178 4:83774244-83774266 CTGTGCATCTTCCTGTTATAAGG + Intergenic
977478184 4:97539296-97539318 CTGTGTCTCTGCATGTGAGATGG - Intronic
979149885 4:117297858-117297880 CTGTACCTCTGGCAGTTATGGGG + Intergenic
981161808 4:141507778-141507800 GTGTGCCTCTGCATGTGAGATGG + Intergenic
982790605 4:159587015-159587037 CTGGGCCTCTGGGTCTGAGATGG + Intergenic
983011144 4:162549340-162549362 CTGTGGCTCTGTCTGTGAAATGG + Intergenic
983173882 4:164565346-164565368 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
983648154 4:170012569-170012591 CTGTACCCCTGGCTGATGGAGGG + Intronic
983781188 4:171672794-171672816 CTCTCCCTTTGGCTGATAGATGG + Intergenic
984307808 4:178017150-178017172 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
984507366 4:180636602-180636624 CTGTTCCCCTGGAGGTTAGAAGG + Intergenic
985161872 4:187052741-187052763 GTGTGCCTCTGCATGTGAGATGG - Intergenic
986885431 5:12228071-12228093 CTGTGCCTGTGGCTATTAATTGG + Intergenic
987731091 5:21773911-21773933 GTGTGCTTCTGGTTGTAAGAAGG + Intronic
988270995 5:29016526-29016548 ATGTGCCTGTGGCTCTTGGATGG - Intergenic
988547439 5:32172139-32172161 ATGTTCCTCTGGCTGTGAAAGGG - Intronic
989345080 5:40421075-40421097 GTGTGTCTCTGGATGTGAGATGG + Intergenic
989653606 5:43720068-43720090 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
989674273 5:43955125-43955147 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
991537979 5:67694189-67694211 CTGCAGCTCTGGCTGTTAAAAGG + Intergenic
992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG + Intergenic
996639799 5:125738746-125738768 GTGTGTCTCTGCATGTTAGATGG + Intergenic
996992576 5:129653130-129653152 CCATGCCTCTGGCTGTTATTTGG + Intronic
997353006 5:133244256-133244278 CTGTGCTTGTGTCTGGTAGAAGG - Intronic
998127566 5:139634782-139634804 CTGTCCCTGTCCCTGTTAGAAGG + Intergenic
998282366 5:140823743-140823765 CTGTGGCTGTGGCTGTCAGCGGG - Exonic
999230487 5:150058974-150058996 ATGTGGCTCTGTCTGTTGGATGG + Intronic
999311725 5:150555786-150555808 CTCTGCCTCTGGCTATGGGAAGG + Exonic
1000591821 5:163167296-163167318 GTGTGCCTCTGCATGTGAGATGG - Intergenic
1000751152 5:165097818-165097840 CTGTGCCTCTGGGTCTGTGATGG + Intergenic
1002011279 5:176283778-176283800 GTGTGCCTCTGCATGTGAGATGG - Intronic
1002957126 6:1877147-1877169 CTGTGCCTCTGGCTGTTAGATGG - Intronic
1002964867 6:1954286-1954308 CTGTGCCTTTTGCTGGTAGAGGG + Intronic
1005085044 6:21997267-21997289 CTGTACTTCTGGCTGTTACCAGG - Intergenic
1005396517 6:25387894-25387916 CTTTGCCTCTAGCTGTGAGTTGG + Intronic
1005829361 6:29658267-29658289 CTGTGCCTCTGTCAGTCAGGTGG - Intronic
1010671834 6:78695239-78695261 CTGAGGGTCTGACTGTTAGAAGG + Intergenic
1011098476 6:83694322-83694344 CTATGCATCTGGCTGACAGAGGG - Intronic
1011627716 6:89296900-89296922 TTCTGCCTCTGGCTGTTCGGTGG + Intronic
1012972178 6:105743205-105743227 CTGGGCCTCTGTGTTTTAGATGG + Intergenic
1014100886 6:117510320-117510342 CTGTGTCTGTGTGTGTTAGAAGG - Intronic
1014387538 6:120819964-120819986 GTGTGCCTCTGCATGTGAGATGG - Intergenic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1015047001 6:128787955-128787977 CAGTGGGTCTGACTGTTAGAAGG + Intergenic
1015291315 6:131540809-131540831 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
1019097013 6:169590507-169590529 CTCTGCCTCTTGCTGTAAGGAGG - Intronic
1019292406 7:257216-257238 CTCTGCATCTGGCTCTGAGATGG - Intronic
1019795589 7:3045809-3045831 CTGTGGGTCTTGGTGTTAGAAGG - Intergenic
1019978462 7:4603284-4603306 CTGTGGCTTGGGCTGCTAGAAGG - Intergenic
1020443298 7:8241668-8241690 GTGTGTCTCTGTCTGTGAGATGG - Intronic
1022141048 7:27493030-27493052 CTGTGCATCTGGATGATAGCTGG + Intergenic
1023386801 7:39666348-39666370 CTGTGCCTGTGTGTGTTGGAAGG + Intronic
1023998620 7:45177054-45177076 CTGTGCCACTGCCTGTGAGGCGG + Intronic
1025002796 7:55331398-55331420 CTGTCACTCTGGCTCTGAGAAGG + Intergenic
1026440282 7:70438103-70438125 ATCTGCCTCTGGTTGTCAGAGGG + Intronic
1031256876 7:119463806-119463828 GTGTGTCTCTGGATGTGAGATGG - Intergenic
1031980423 7:128121120-128121142 CTGCCCCTCTGGCTGGGAGAGGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034401660 7:150865634-150865656 CTGTGCCTCTCCCAGTTAGGGGG + Intergenic
1035681584 8:1492661-1492683 CTCTGCCTCCGGCTGTGAGGAGG - Intergenic
1036217397 8:6892099-6892121 CTGGGCCTCTGGCTTGCAGATGG + Intergenic
1037645964 8:20793037-20793059 CTGTGACTCAGGCTGTTAGCAGG + Intergenic
1038796919 8:30718266-30718288 CTGTGCATCAGGTTGTTAGAGGG + Intronic
1039127273 8:34217174-34217196 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
1039170586 8:34740290-34740312 GTGTGTCTCTGTCTGTGAGATGG - Intergenic
1039196174 8:35034106-35034128 GTGTCCCTCTGTGTGTTAGATGG - Intergenic
1041133042 8:54722971-54722993 CTGAGCCTCTTGCTGTTTGGTGG - Intergenic
1043016516 8:74946540-74946562 GTGTGCCTCTGCATGTGAGATGG + Intergenic
1043747987 8:83900004-83900026 GTGTGCCTCTGCATGTGAGAAGG - Intergenic
1043819161 8:84841221-84841243 GTGTGCCTCTGCATGTGAGATGG - Intronic
1048090501 8:131235496-131235518 GTGTGCCTCTGCATGTGAGATGG + Intergenic
1048696931 8:137038854-137038876 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1051482447 9:17575292-17575314 CTGTGCCTCTGGCTCATACCGGG - Intergenic
1052222558 9:26044955-26044977 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
1052842345 9:33303412-33303434 CTGTGGCTCTAGCTGTGTGATGG - Intronic
1053084012 9:35202737-35202759 ATGTGTCTCTGCCTGTCAGATGG + Intronic
1053445378 9:38149139-38149161 CTGTTGTTCTGGCTTTTAGAAGG - Intergenic
1055983594 9:82032238-82032260 CACTGCCTCTGGCTGGCAGAGGG - Intergenic
1057140223 9:92722283-92722305 CTGTGTCTCTGCCTGTGACAGGG - Intronic
1058243644 9:102598759-102598781 GTGTGCCTCTGCATGTGAGATGG + Intergenic
1061261585 9:129483292-129483314 CTGTGCCCCTGGCTCTGCGAGGG - Intergenic
1062298429 9:135848157-135848179 CAGTGTTTCTGGCTGTAAGATGG + Intronic
1062568659 9:137174480-137174502 CTGCGCCTCTGGCCTTTAGAAGG - Intergenic
1203384652 Un_KI270438v1:12597-12619 CTGAGGGTCTGCCTGTTAGAAGG + Intergenic
1186201448 X:7159036-7159058 GTGTGCCTCTGGCTCTCAGTAGG - Intergenic
1188244248 X:27821426-27821448 CTCTGCCTCTGCTTGTTTGAAGG + Exonic
1190221257 X:48513824-48513846 ATTTGTGTCTGGCTGTTAGAGGG + Intronic
1191068161 X:56372367-56372389 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
1192044996 X:67663012-67663034 GTGTGTCTCTGCATGTTAGACGG + Intronic
1192149634 X:68704215-68704237 CTGAGCCACTGGGTGTTAGGGGG + Intronic
1194147343 X:90280347-90280369 CTGTTCCTCTGTCTCATAGAGGG - Intergenic
1194249977 X:91562729-91562751 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1195391211 X:104364528-104364550 CTGTGTCTCTGCATGTGAGATGG + Intergenic
1196235370 X:113274037-113274059 GTTTCCCTCTGTCTGTTAGAAGG + Intergenic
1197261775 X:124327585-124327607 CAGTGCCTCTGTCTGTAAAATGG + Intronic
1197298958 X:124755376-124755398 GTGTGTCTCTGCCTGTGAGATGG + Intronic
1197923500 X:131621558-131621580 CTGTGCCAAGGGCTGTTATAAGG - Intergenic
1198507719 X:137317955-137317977 CTGTGCCTCTGTCTATGAAATGG - Intergenic
1198595685 X:138232968-138232990 GTGTGCCTCTGCATGTGAGATGG - Intergenic
1200493748 Y:3857109-3857131 CTATTCCTCTGTCTGATAGAGGG - Intergenic
1200568940 Y:4803978-4804000 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1201441075 Y:14009028-14009050 CTCTGCCTCTGGTTGTTAGCAGG + Intergenic
1201443496 Y:14033680-14033702 CTCTGCCTCTGGTTGTTAGCAGG - Intergenic
1201536218 Y:15051570-15051592 GTGTGTCTCTGCATGTTAGATGG + Intergenic
1201606357 Y:15790072-15790094 GTGTGTCTCTGCATGTTAGATGG + Intergenic
1201778596 Y:17693973-17693995 GTGTGTCTCTGCCTGTGAGATGG + Intergenic
1201795997 Y:17896885-17896907 GTGTGCCTCTGTATGTGAGACGG - Intergenic
1201805558 Y:18009100-18009122 GTGTGCCTCTGTATGTGAGACGG + Intergenic
1201822960 Y:18212019-18212041 GTGTGTCTCTGCCTGTGAGATGG - Intergenic
1202374757 Y:24224126-24224148 GTGTGTCTCTGCATGTTAGATGG - Intergenic
1202496023 Y:25445994-25446016 GTGTGTCTCTGCATGTTAGATGG + Intergenic