ID: 1002963117

View in Genome Browser
Species Human (GRCh38)
Location 6:1936257-1936279
Sequence CAATGTGAGCAGTGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002963112_1002963117 26 Left 1002963112 6:1936208-1936230 CCACACTAAGAATAAAATATCAT 0: 1
1: 0
2: 2
3: 35
4: 543
Right 1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002963117 Original CRISPR CAATGTGAGCAGTGGCAAGA GGG Intronic
No off target data available for this crispr