ID: 1002963228

View in Genome Browser
Species Human (GRCh38)
Location 6:1937160-1937182
Sequence GAGTGTTCCACAAGCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002963228 Original CRISPR GAGTGTTCCACAAGCCTGGA TGG (reversed) Intronic
900211768 1:1459710-1459732 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900224577 1:1527010-1527032 GGGTGGGCCCCAAGCCTGGAGGG - Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
901441110 1:9279000-9279022 GAGTGTTGCACAGCCCTGGGTGG + Intergenic
902206705 1:14873599-14873621 AAGTCTTCCAAAAGCCTGAAAGG - Intronic
905356974 1:37391540-37391562 GAATGCTCAAAAAGCCTGGAAGG + Intergenic
910849882 1:91639675-91639697 GAGTGCTCTGCAAGCCTGAAGGG - Intergenic
912507831 1:110168270-110168292 AAGAGTTCCACAAGCAAGGAAGG - Intronic
913432448 1:118810037-118810059 GAGGGTTCCACAAGGCTGTCTGG + Intergenic
917601464 1:176578411-176578433 TAGGGTTCCCCAAGACTGGAGGG + Intronic
922343938 1:224680449-224680471 TAGATGTCCACAAGCCTGGACGG - Intronic
922769549 1:228174684-228174706 GAGTGTTCCTGGAGCCTGCAGGG - Exonic
924599133 1:245472802-245472824 GAGGGTTCCCCAGGCCTGCATGG + Intronic
1063094398 10:2896850-2896872 GAATTTTATACAAGCCTGGATGG + Intergenic
1066265113 10:33769377-33769399 GAGGGTTCCTTGAGCCTGGAAGG - Intergenic
1069571230 10:69495513-69495535 AGGTTTTCCAGAAGCCTGGATGG - Intronic
1072523380 10:96249878-96249900 GAGTGTTCCACTGGCATGGAAGG + Intronic
1075723002 10:124598233-124598255 GAGCGTCCCATCAGCCTGGAGGG + Intronic
1076613664 10:131742787-131742809 CAGTGTTCGCCAGGCCTGGAGGG - Intergenic
1078505473 11:11938762-11938784 TAGCGTTCCACATGCCTTGAGGG + Intronic
1080212998 11:29808582-29808604 GAGTGTTGCAATAGCCTAGAGGG - Intergenic
1081056524 11:38416182-38416204 GAGAATCCCACAAACCTGGATGG + Intergenic
1083053826 11:59800770-59800792 GAGTCAGCCACAAACCTGGAAGG - Intronic
1084169458 11:67393683-67393705 GAGTCTTCCGCACCCCTGGATGG - Exonic
1084177582 11:67431468-67431490 GAGTTTGCCACCAGTCTGGAAGG - Exonic
1084519602 11:69655401-69655423 GAGTGCTCTACAAGGCAGGAAGG - Intronic
1087997104 11:104822618-104822640 TAGAGTTCCACATGGCTGGAAGG - Intergenic
1088862710 11:113817117-113817139 GATTGTTGCACATGACTGGATGG + Intronic
1091265924 11:134270953-134270975 GAGTCTTCCACCAGACTTGAAGG + Intergenic
1092804368 12:12206123-12206145 GTGTGTTACACAAACCTAGATGG - Intronic
1095908751 12:47404713-47404735 AACTGTTCCACATGCATGGATGG + Intergenic
1096406598 12:51348416-51348438 GAGTGTGCCAGAATGCTGGAGGG - Intergenic
1096691040 12:53321886-53321908 GGGTGATCCACAGGCCTGGGAGG - Intronic
1098652901 12:72995976-72995998 AAGTGTGTCAAAAGCCTGGAAGG - Intergenic
1098944484 12:76574396-76574418 CAGTGTTCCACAGGCCTCTAGGG + Intergenic
1099768406 12:87020766-87020788 GGGTGTTCCAAATGTCTGGATGG - Intergenic
1099980594 12:89597134-89597156 AAATGTTCCACAAGCCTTTATGG - Intronic
1101697275 12:107138594-107138616 GAGTCTTGCACCAGGCTGGAGGG + Intergenic
1106527841 13:30558867-30558889 GAGTTTTTCACAAGCCTCCAAGG + Intronic
1112642935 13:101297500-101297522 GGGTGTTCCATATCCCTGGAGGG - Intronic
1113756157 13:112812479-112812501 GTGCGTTCCAGAAGCCTGGAGGG + Intronic
1114495897 14:23131846-23131868 GGGTGTTCCCAATGCCTGGAAGG + Intronic
1116065191 14:39973082-39973104 GAGGGTCCCACAAGCCTGGGTGG + Intergenic
1118190540 14:63576113-63576135 GAGTTTTCTGTAAGCCTGGATGG + Intergenic
1121615937 14:95313854-95313876 GAGTGTTCCACAGGTCAGGGAGG + Intronic
1122133242 14:99618338-99618360 CAGTGTTCCTCAGGCCTGGGTGG - Intergenic
1122951207 14:105046101-105046123 GACTGTCCCACAGGCCTGGTGGG - Intergenic
1125703626 15:41711217-41711239 GAGATTTAGACAAGCCTGGAGGG - Exonic
1128581959 15:68817324-68817346 GAGGGTTCCCCTAGCCTGCAGGG + Intronic
1138683134 16:58701331-58701353 CACTGTTCCACATGACTGGAAGG - Intergenic
1141171556 16:81694848-81694870 AAGTGTTCCTCAGGCATGGAGGG + Intronic
1141917917 16:87112874-87112896 GATTCTTCCACAACCCTGGGAGG + Intronic
1142768920 17:2082621-2082643 GAATGTGCCACCAGCCTGGCAGG - Intronic
1144051109 17:11497834-11497856 GAGTGCTCTGCAAGCCTGGGGGG - Intronic
1147669193 17:42167041-42167063 GAGAGTTCAACAAGCCAGGGTGG - Intronic
1149837493 17:59926535-59926557 GAGTTTTCCACCAGTCTGAAAGG - Exonic
1150081853 17:62247031-62247053 GAGTTTTCCACCAGTCTGAAAGG + Intergenic
1150454736 17:65298138-65298160 AAGTGTTCCCCTAGCCTGGCAGG - Intergenic
1155846704 18:30716844-30716866 GAGTGTTCAACAAACGTGGAGGG - Intergenic
1157811533 18:50700576-50700598 CAGTTTTCCACAACCCTGGTTGG - Intronic
1157955128 18:52088375-52088397 TTGTGTTCCAAAATCCTGGAGGG - Intergenic
1158253413 18:55516534-55516556 GAGTGATCCGGAGGCCTGGATGG + Intronic
1160255429 18:77244204-77244226 CAGTCTTCCAGGAGCCTGGAAGG + Intergenic
1162770182 19:12944607-12944629 GAGTGTTCCACAAGATTCCAGGG + Intergenic
1163189031 19:15662340-15662362 GAGTTTTCTACAAACCTGCAAGG - Exonic
925148882 2:1601121-1601143 GAGTGTTGGACAGTCCTGGAGGG - Intergenic
926706351 2:15840500-15840522 GGGTCTTCCCCAAGCTTGGAGGG - Intergenic
929509750 2:42557339-42557361 CATTGTTCTAGAAGCCTGGAGGG + Intronic
932194379 2:69770484-69770506 GAATGTGCCACAAGGCTGGCAGG + Intronic
932718664 2:74122349-74122371 GAGGTTTGCACAAGACTGGAAGG + Intergenic
940361697 2:152803102-152803124 GTGTGTTCTACCAGTCTGGAAGG + Intergenic
941403477 2:165060563-165060585 AAGTGTTGAACAAGCCTAGAGGG - Intergenic
944260296 2:197668854-197668876 GAGAGTTCCTCAATCCTTGAGGG - Intronic
945148403 2:206762825-206762847 CAGTGTTTCAAAAGCCTGGAAGG - Intronic
945933138 2:215876296-215876318 GAGTATTGCTCAAGCCTGGGAGG + Intergenic
948208373 2:236174791-236174813 GAGGGTTCCAAGAGCCTGAAGGG - Intergenic
948228795 2:236334710-236334732 GAGTTTTCCAAAAGCCTGAGAGG + Intronic
1171080001 20:22170982-22171004 GAGCTTTCCACAGGCCCGGAAGG - Intergenic
1175653233 20:60747111-60747133 GAGTGTCCCATGAGCCTGAATGG - Intergenic
1180009756 21:45041521-45041543 GAGGGTTACACAACCCAGGACGG + Intergenic
1181557992 22:23683154-23683176 GAATGTTCCAGCAACCTGGATGG + Intergenic
1183321660 22:37168691-37168713 GAGTGTTCCATAGGCCGGAATGG + Intronic
954516347 3:51180988-51181010 CAGTGTTACAGAAACCTGGAAGG + Intronic
958637767 3:96766556-96766578 GAGGGTCCCACAAGCCTAGGTGG - Intergenic
962068524 3:132009365-132009387 GGGTGTTTAACAAGCATGGAGGG - Intronic
965421274 3:168462106-168462128 ATGTGTTCCACAAGACTGAAAGG + Intergenic
967236877 3:187393612-187393634 GAGAATCCCACAAGCCTGGGAGG - Intergenic
968795329 4:2700001-2700023 GAGTGGTTCATATGCCTGGATGG - Exonic
968971468 4:3797915-3797937 GAGTGGTCCAGGAGCCTGGGGGG + Intergenic
974017346 4:56659617-56659639 CAGTGCTTCTCAAGCCTGGATGG + Intronic
974614797 4:64267132-64267154 CAGTGTTCCACAAGTCTCTAGGG + Intergenic
976446937 4:85140779-85140801 GAGTCTCCCACACGTCTGGATGG + Intergenic
979212332 4:118120272-118120294 GAGTGTGCCACAAGGATGCAGGG + Intronic
980379231 4:131989972-131989994 GAGGGGCCCACAAGCCTGGGTGG + Intergenic
982436325 4:155385477-155385499 GATGGTTCTAGAAGCCTGGAAGG - Intergenic
985520435 5:371680-371702 GTCGGTTCCACAGGCCTGGAAGG - Intronic
986165856 5:5271031-5271053 GAGGGTTCCACAAGGATTGAGGG + Intronic
986175893 5:5351638-5351660 GAGAGCTCCACATGCCTGGAGGG + Intergenic
990089863 5:52029794-52029816 GTGTATTACACAAGCCTAGATGG + Intronic
990782396 5:59379987-59380009 GAGGATTCCAAAAGCCAGGAGGG - Intronic
990996965 5:61742268-61742290 GAGTGGACCTCAGGCCTGGATGG + Intronic
992215619 5:74522267-74522289 GTGTGTTCTAAAAGGCTGGAGGG + Intergenic
992563619 5:77976186-77976208 AACTGTTCCAAATGCCTGGAAGG + Intergenic
992741362 5:79776634-79776656 CAGTGTTCCCCAAGCCTGCCTGG - Intronic
999693947 5:154171760-154171782 GCTTGTTCCACCAGCCTGCAGGG - Intronic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1004549477 6:16632637-16632659 TAGTGCTCCAAAAGCCAGGAGGG + Intronic
1005155657 6:22803151-22803173 GAATTTTCCACCAGTCTGGATGG + Intergenic
1007103331 6:39266656-39266678 TAGTGTTACACAAACCTAGATGG - Intergenic
1008513214 6:52296678-52296700 GAGGGTCCCATAAGCCTGGTCGG - Intergenic
1010832867 6:80552369-80552391 AATTTTTCCACAAACCTGGAAGG - Intergenic
1012957959 6:105591086-105591108 GAGAGATTCACAAGGCTGGAGGG - Intergenic
1017964724 6:159254232-159254254 GAATGTTGTACAAGCCTGCAAGG - Intronic
1018175193 6:161172380-161172402 GTGTGTACCCCAGGCCTGGATGG - Intronic
1018488373 6:164266403-164266425 GAGTGCTATACAATCCTGGAGGG - Intergenic
1018579179 6:165292968-165292990 GAGTGTTTAACAAACTTGGAGGG + Intronic
1022993603 7:35731817-35731839 GACTGTTCCCCCTGCCTGGAAGG - Intergenic
1028650062 7:93141142-93141164 TAGTGTCCCAAAAGCCTGCAAGG - Intronic
1029802957 7:102969365-102969387 GAGTGCTACACAAACCTAGATGG - Intronic
1031975281 7:128089749-128089771 GACTGTTCCACAAGCCAGGAAGG + Intronic
1034293461 7:149950284-149950306 GTGTATTTCACAAGCCTGCAGGG + Intergenic
1034812604 7:154146569-154146591 GTGTATTTCACAAGCCTGCAGGG - Intronic
1034984160 7:155497148-155497170 AACTGTTCCACAGTCCTGGAGGG + Intronic
1036224218 8:6944465-6944487 GAGTGCTGCAGAAACCTGGATGG + Intergenic
1036627033 8:10480590-10480612 GAATGTACCAGAAGCCAGGAGGG + Intergenic
1038937976 8:32273305-32273327 AAGTGTTCCAAAAGTCGGGAGGG - Intronic
1038940018 8:32294041-32294063 GGGTGTTCCCCCAGCATGGATGG - Intronic
1040416357 8:47199175-47199197 GAGGATTGCTCAAGCCTGGAAGG - Intergenic
1040980073 8:53237931-53237953 GTGTCTTCCAGAAACCTGGAAGG - Intronic
1042039583 8:64577946-64577968 GTTTGTTCCAGAAGCTTGGATGG + Intergenic
1050043072 9:1515697-1515719 AAGGGTCCCACAAGCCTGGGAGG - Intergenic
1050864494 9:10480765-10480787 AAGAGTTCCACAAGCCTACAAGG + Intronic
1051602773 9:18891217-18891239 AAGTGTTCCAAATGCCTGGCAGG - Intronic
1053032089 9:34789083-34789105 GAGGCTCCCACAGGCCTGGATGG + Intergenic
1055914884 9:81390937-81390959 GACTCTTCCACAAGCAAGGAGGG - Intergenic
1057064759 9:92038400-92038422 GAGCGATCTTCAAGCCTGGAAGG - Intronic
1057143094 9:92739195-92739217 GATTTTTCAACAAGCCTGGGTGG - Intronic
1057911272 9:99022160-99022182 GTGTGTGTGACAAGCCTGGATGG - Intronic
1059538098 9:115102434-115102456 GAGGGTTCCAGATGCCTTGAAGG + Intronic
1060235094 9:121857140-121857162 GAGTTTTCCTCACTCCTGGAAGG - Intronic
1060600419 9:124873713-124873735 GAGAGTTCCGCAAGGCTGCATGG - Exonic
1060883912 9:127137265-127137287 GAGTGGGCCACTAGTCTGGAGGG - Intronic
1061448474 9:130655644-130655666 GTGTGTTACACTGGCCTGGAAGG - Intergenic
1062292663 9:135803972-135803994 GGGTTTCCCACAAGCCTGGCTGG - Intergenic
1062734055 9:138125496-138125518 GGGGGTCCCACAAGCCTGGGTGG + Intergenic
1186075649 X:5875298-5875320 GTGTGTCCCACAAGCCTGGAAGG + Intronic
1188223034 X:27563421-27563443 CAGAGTTCCACTAGCCTTGAGGG + Intergenic
1192837121 X:74811894-74811916 GAGTTTTCTCCATGCCTGGAAGG - Intronic