ID: 1002972688

View in Genome Browser
Species Human (GRCh38)
Location 6:2040298-2040320
Sequence GTTGATCAGCACCAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002972684_1002972688 -2 Left 1002972684 6:2040277-2040299 CCAATAAGAACATTCATCAATGT 0: 1
1: 0
2: 0
3: 25
4: 258
Right 1002972688 6:2040298-2040320 GTTGATCAGCACCAGGTGGTGGG 0: 1
1: 0
2: 2
3: 16
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002972688 Original CRISPR GTTGATCAGCACCAGGTGGT GGG Intronic
900534530 1:3170444-3170466 GTGGATTAGGACCAGGTGCTGGG + Intronic
900624994 1:3603941-3603963 TTTGTTCAGCACAAGGGGGTGGG - Intronic
901056944 1:6452821-6452843 GCTGATCAGCACCAGCTGGCAGG + Intronic
901706374 1:11076559-11076581 GTTGAACAGCACCTAGTGGGAGG - Intronic
902477433 1:16695674-16695696 GCTGATCAGCACCAGCTGGCAGG - Intergenic
904625149 1:31798264-31798286 GCTCATCCGCACCAGGTCGTAGG + Exonic
906891944 1:49726154-49726176 GTTTATCAGATCAAGGTGGTTGG + Intronic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
919867022 1:201789997-201790019 GTTGCTCAGGAGCTGGTGGTGGG - Intronic
922808179 1:228401358-228401380 TCTGGCCAGCACCAGGTGGTGGG - Intronic
1064117208 10:12588600-12588622 GTTGAGCAGGTGCAGGTGGTGGG - Intronic
1070158501 10:73851243-73851265 GATGATCAAAACCAGGTTGTAGG + Intronic
1076657389 10:132033919-132033941 GCTGATCAGCATCATTTGGTGGG - Intergenic
1076807520 10:132866504-132866526 GTTGTTCGGCACCACGAGGTGGG - Intronic
1081179027 11:39965224-39965246 GAGGAGCAGCATCAGGTGGTTGG - Intergenic
1081694501 11:45100536-45100558 GATGATGAGCACCAGTGGGTGGG - Intronic
1082991647 11:59211954-59211976 GTCGATGGCCACCAGGTGGTTGG + Exonic
1083000751 11:59288577-59288599 GTCGATGGCCACCAGGTGGTTGG + Intergenic
1086900991 11:92367221-92367243 GTGGATCAGCACCAGCTTGTAGG + Intronic
1092174121 12:6391166-6391188 GCTGAGCAGCCCCAGGGGGTGGG - Exonic
1093855313 12:24094705-24094727 GTTGCTCAGTACATGGTGGTAGG - Intergenic
1094855222 12:34399872-34399894 GTTGACCAGCCCAAGGTGGCAGG + Intergenic
1099145116 12:79033507-79033529 TTTGATCAGAATTAGGTGGTTGG + Intronic
1100553782 12:95672312-95672334 CTGGATCAGCACCAGTTTGTAGG - Intronic
1107793841 13:44030002-44030024 GCTGAGCAGCACCATGTGGTTGG + Intergenic
1109198410 13:59404766-59404788 TTTGCTCAGCACCACATGGTTGG + Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1117635300 14:57736591-57736613 GCTGATCAGCAACAAGTGGATGG + Intronic
1119473655 14:74914355-74914377 CTTGCCCAGGACCAGGTGGTGGG - Intronic
1120506675 14:85361457-85361479 GTTGGTGAGCACCTGCTGGTAGG + Intergenic
1121485259 14:94309852-94309874 GTTCATCTGCACCAGCTGGCAGG + Exonic
1122650762 14:103225335-103225357 TTTCATCATCACCAGGTGATAGG + Intergenic
1131409998 15:92199678-92199700 GAGGAACAGCATCAGGTGGTTGG + Intergenic
1137534099 16:49304501-49304523 GTCTATCAGCACCATGTGGTTGG - Intergenic
1141154005 16:81584174-81584196 GCCCACCAGCACCAGGTGGTGGG + Intronic
1141853932 16:86668094-86668116 CTTCATCAGCCCCAGGAGGTAGG - Intergenic
1141916075 16:87098171-87098193 TTTAAACAGCACCAGGTGGTGGG + Intronic
1143500328 17:7335110-7335132 GTACATCAGCAACAGGTGGAAGG + Intergenic
1143619590 17:8073371-8073393 GGTGGTCAGCACCTGGTGGAAGG - Intronic
1144396909 17:14853128-14853150 GTTGAACTGAAGCAGGTGGTAGG + Intergenic
1144833343 17:18143797-18143819 GTGGGTCAGCACCAGGCGGGGGG + Intronic
1147441260 17:40448575-40448597 GATGAGTAGCACCAGGTGGCTGG + Intronic
1147520467 17:41167625-41167647 GTTGTTCTACAGCAGGTGGTCGG + Exonic
1148714193 17:49704131-49704153 GATGTTCAGCATCATGTGGTTGG + Exonic
1149425602 17:56551492-56551514 GTTTATCAGGACCAGGTCTTTGG - Intergenic
1149439768 17:56664383-56664405 GAAGATGAGCACCAGGAGGTGGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1150069620 17:62139916-62139938 GTGGACCACCAGCAGGTGGTGGG + Intergenic
1151020384 17:70609762-70609784 GTTGATCAGCACTAGGTGCTGGG + Intergenic
1151140808 17:71990464-71990486 GTTGATAAGCAAGAGGTAGTGGG - Intergenic
1152090207 17:78242283-78242305 GTTTATCTGCACCACCTGGTAGG + Intergenic
1160382160 18:78468098-78468120 GGTGATGGGTACCAGGTGGTTGG + Intergenic
1161539988 19:4844750-4844772 GTTGATCAGAAGCTGGTGGAAGG - Exonic
1161646012 19:5453897-5453919 GTTGGTCAGAACCAGGGGTTAGG + Intergenic
1164738098 19:30556926-30556948 GTTGATCAGCACTAAGTAATAGG - Intronic
1166811646 19:45517918-45517940 GTTGATGACCACCTGGTGGGAGG - Exonic
1167812836 19:51849819-51849841 GTTTATCTGCACCAGTTGATAGG - Intergenic
1168289441 19:55350379-55350401 GCTGGGCAGCACCGGGTGGTGGG + Exonic
1168403457 19:56098957-56098979 GTGCCTCAGCCCCAGGTGGTGGG - Intronic
1202711452 1_KI270714v1_random:21500-21522 GCTGATCAGCACCAGCTGGCAGG - Intergenic
926359485 2:12072432-12072454 CTTGATTAGCACCAACTGGTAGG - Intergenic
927656123 2:24948194-24948216 GTTTATCAGGCCCAGGTGTTGGG - Intronic
928799377 2:35068168-35068190 CCTGTTCAGCCCCAGGTGGTGGG - Intergenic
930529467 2:52572111-52572133 GTTGAACTGCTCCAGCTGGTGGG - Intergenic
935347379 2:102121193-102121215 GGTGGTCAGCACCGGGTGGCTGG - Intronic
936283186 2:111160407-111160429 GCTGACCAGCATCAGGTGGGGGG - Intronic
937990020 2:127657056-127657078 GGGCATCAGCACCAGCTGGTGGG + Intronic
940026287 2:149211963-149211985 GTAGATAAGCAGGAGGTGGTGGG + Intronic
942706875 2:178784008-178784030 ATTGAGCAGGGCCAGGTGGTTGG - Intronic
946812507 2:223540934-223540956 GGAGGACAGCACCAGGTGGTTGG - Intergenic
947651907 2:231793832-231793854 GTTGCACACCTCCAGGTGGTTGG + Intronic
948289607 2:236815582-236815604 GTTGATCATCACCATGTGCCAGG - Intergenic
1174170996 20:48618211-48618233 TTTGATCAGCGCCAGGCTGTGGG - Intergenic
1174449976 20:50613832-50613854 GGTGACCAGCAGCAGATGGTGGG - Intronic
1180607975 22:17075547-17075569 GTTAAGCAGCACCATGTGGTAGG - Intergenic
1183150367 22:36032258-36032280 GTTGAACAGGATCAGGTTGTGGG - Intergenic
1184043343 22:41957499-41957521 GCTGATCAAGACCACGTGGTAGG - Intergenic
1184496019 22:44841950-44841972 CCTGATCAGCACCAGGTGCGGGG + Intronic
1184835813 22:47020256-47020278 GCTGACCAGCAGCCGGTGGTGGG + Intronic
949310053 3:2687292-2687314 GTTGCTGAGCAGCAAGTGGTGGG - Intronic
950656658 3:14440945-14440967 CTGGCTCAGCCCCAGGTGGTGGG + Intronic
952902216 3:38117828-38117850 GTTGGTCAGCTTCAGGTGGTGGG - Exonic
953626748 3:44578434-44578456 GTTGTTCAGCTCCTGGTTGTGGG + Intronic
954616118 3:51969510-51969532 CATGATCAGCACCCGGTGGTTGG + Exonic
960916003 3:122695529-122695551 AGTCATCAGCACCAGGTGGCAGG - Exonic
962755415 3:138462121-138462143 GTTGGGCAGCACCAGGTGGGTGG - Exonic
966009061 3:175053390-175053412 CTTGATCCTCCCCAGGTGGTTGG + Intronic
966778209 3:183561449-183561471 GTTGCTCAGAACCACCTGGTAGG - Intergenic
966864457 3:184249586-184249608 GTTGAGCAACTGCAGGTGGTGGG + Intronic
967167004 3:186790028-186790050 GTTCATCAGCACCATCTGCTAGG + Exonic
968682332 4:1929702-1929724 ATTGAACAGAAACAGGTGGTGGG + Intronic
969721836 4:8896337-8896359 GTTGTGCAGCTCCAGGTGGCTGG - Intergenic
975932135 4:79537885-79537907 GTTTTCCAGGACCAGGTGGTGGG - Intergenic
976508520 4:85880027-85880049 ATGGATCAGTACCAGGAGGTTGG + Intronic
983523814 4:168739269-168739291 TTGGATCAGTACCCGGTGGTAGG + Intronic
983760976 4:171406265-171406287 GTTGGTGAGCAGCAGGTGATGGG - Intergenic
985828107 5:2207721-2207743 GGTGACCAGCAGCATGTGGTGGG - Intergenic
986535772 5:8785421-8785443 GTTGTTCACCACCAGGAGGAAGG - Intergenic
989203152 5:38785899-38785921 GTTAATTGGCACCAGGTAGTGGG + Intergenic
991632081 5:68666391-68666413 GTTGAGCAGTAACAAGTGGTGGG + Intergenic
995485485 5:112636196-112636218 TTTGTTCAGCACTTGGTGGTTGG - Intergenic
998140876 5:139698736-139698758 GGTGGGCAGCACCAGGGGGTGGG + Intergenic
1001220741 5:169898295-169898317 ATTGCTCAGCACCATGTGATTGG + Intronic
1002846548 6:950907-950929 ACTGAACAGCACCAGGAGGTAGG - Intergenic
1002972688 6:2040298-2040320 GTTGATCAGCACCAGGTGGTGGG + Intronic
1004167129 6:13266754-13266776 CTAGAACAGCACCAAGTGGTTGG + Exonic
1004890774 6:20098284-20098306 CGTGCTCTGCACCAGGTGGTGGG + Intergenic
1008678603 6:53847694-53847716 ATTGATCAGCATCTCGTGGTTGG - Intronic
1010014411 6:71087549-71087571 GCTGATAAGCACTAGCTGGTAGG + Intergenic
1014396754 6:120932906-120932928 GTTGATCAGCACCAATTAGCAGG + Intergenic
1015360906 6:132338330-132338352 CTAGAACAGAACCAGGTGGTAGG - Intronic
1015795502 6:137007142-137007164 CTTGATCAGTGCCAGCTGGTGGG - Intronic
1019778090 7:2924262-2924284 GTTGACCTGCTCCAGGTCGTAGG + Exonic
1022469653 7:30674474-30674496 GTTCATCTGCACCAGGTGGGTGG - Intronic
1025191294 7:56897832-56897854 GGTGGTCAGCACCAGGTGCTGGG - Intergenic
1025680652 7:63679102-63679124 GGTGGTCAGCACCAGGTGCTGGG + Intergenic
1033831928 7:145265390-145265412 GTTGGTCAGCAGCAGCTGGGAGG - Intergenic
1037876349 8:22550819-22550841 GTTGATCAGTAACTGTTGGTTGG + Intronic
1038347231 8:26743532-26743554 GTTTAGCAGCACCAGGTGGTTGG - Intergenic
1041711058 8:60894916-60894938 GTTGAGCAGCATAAGGTGGTGGG + Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1049234389 8:141505106-141505128 GTAGATGTGCACCCGGTGGTGGG - Intergenic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1051263958 9:15293358-15293380 GTTGCTGAGCACCTGGAGGTGGG + Intronic
1056099129 9:83284210-83284232 GTTGGTCATCACCAGGTAGCAGG + Intronic
1058766238 9:108185226-108185248 GGAGATCAGCACCTGGTGGCTGG + Intergenic
1060601500 9:124881349-124881371 GGTTAGCAGGACCAGGTGGTGGG + Intronic
1187375043 X:18744353-18744375 ATTGATCATCAAGAGGTGGTAGG - Intronic
1190372978 X:49760958-49760980 GCTTCTCAGCACCACGTGGTTGG - Intergenic
1190852481 X:54259308-54259330 GTTGTTCAGCTCCAACTGGTTGG + Exonic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1200753107 Y:6965067-6965089 GTTGATAAGCTGCCGGTGGTTGG + Intronic