ID: 1002975769

View in Genome Browser
Species Human (GRCh38)
Location 6:2074388-2074410
Sequence ACTGATATCCAAAATGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1849
Summary {0: 1, 1: 0, 2: 19, 3: 190, 4: 1639}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002975769_1002975773 24 Left 1002975769 6:2074388-2074410 CCCTGCACATTTTGGATATCAGT 0: 1
1: 0
2: 19
3: 190
4: 1639
Right 1002975773 6:2074435-2074457 AATATTTTTTTCCGCTCAATAGG 0: 1
1: 0
2: 3
3: 45
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002975769 Original CRISPR ACTGATATCCAAAATGTGCA GGG (reversed) Intronic
901891596 1:12270986-12271008 ACTGATAACCAAAACCTGCAAGG - Exonic
902967861 1:20023213-20023235 ACTAATATCCAGAATCTACAAGG - Intergenic
903290314 1:22309109-22309131 ACTTATATCCAAAATACGTAAGG + Intergenic
905330736 1:37194788-37194810 GCTCATATCCAAAATGTGCAAGG + Intergenic
905486850 1:38305113-38305135 GCTAATATCCAAAATATACAAGG + Intergenic
905497831 1:38408458-38408480 ACTAATATCCAGAATCTCCAAGG + Intergenic
906047635 1:42844331-42844353 ACTGATAACCAATATCTCCATGG - Exonic
906867968 1:49443155-49443177 ACTAATATCCAGAATATACAAGG - Intronic
906872594 1:49500255-49500277 ACTAATATCCAGAATCTACAAGG - Intronic
906915052 1:50000184-50000206 ACTAATATCCAGAATCTACAAGG + Intronic
907095792 1:51779651-51779673 ACTAATATCCAGAATCTACAAGG + Intronic
907711570 1:56887579-56887601 GCTAATATCCAGAATCTGCAAGG - Intronic
907779843 1:57556659-57556681 ACTAATATCCAGAATCTACAAGG - Intronic
907886946 1:58600858-58600880 ACTAATATCCAGAATCTACAGGG - Intergenic
907964057 1:59312131-59312153 ACTAATATCCAGAATTTACAAGG - Intronic
908065947 1:60404840-60404862 ACTAATATCCAGAATATACAAGG - Intergenic
908305713 1:62813711-62813733 ACTAATATCCAGAATCTACAAGG + Intronic
908604633 1:65782705-65782727 ACTAATATCCAGAATCTACAAGG + Intergenic
908625485 1:66036203-66036225 GCTAATATCCAAAATATGCAGGG - Intronic
908812259 1:67994899-67994921 ACTAATATCCAAAATGTAGAAGG + Intergenic
908883817 1:68764349-68764371 ACTAATATCCACAATCTACAAGG + Intergenic
909212483 1:72842261-72842283 ACTAATATCCAGAATCTACAAGG + Intergenic
909245954 1:73284681-73284703 CCTAATATCCAGAATCTGCAAGG + Intergenic
909623590 1:77691480-77691502 ACTAATATCCACAATCTACAAGG + Intergenic
909756883 1:79238525-79238547 TTTGAGATCCAAATTGTGCAGGG - Intergenic
910231031 1:84986648-84986670 ACTAATATCCAGAATCTACAAGG + Intronic
910329476 1:86054407-86054429 ACTAATATCCAGAATCTACAAGG + Intronic
910441658 1:87259082-87259104 ACTAATATCCAAAATCTACAAGG - Intergenic
910541372 1:88361888-88361910 ACTAATATCCAGAATCTACAAGG - Intergenic
910736887 1:90468593-90468615 ATTGATATCCAGAATCTACAAGG + Intergenic
910748540 1:90601111-90601133 ACTAATATCCAGAATCTACAAGG + Intergenic
910930634 1:92439803-92439825 ACTGAAATCCAAAATATTCCTGG - Intergenic
910987316 1:93018141-93018163 ACTAATATCCAAAATCTATAAGG + Intergenic
911233995 1:95390336-95390358 ATTAATATCCAAAATATACAAGG - Intergenic
911243236 1:95488327-95488349 TCTGATATCAAAAATCTACAAGG + Intergenic
911318566 1:96384308-96384330 ACTAATATCCAGAATCTACAAGG + Intergenic
911613674 1:99984964-99984986 ACTAATATCCAGAATCTACAAGG - Intronic
911666126 1:100554844-100554866 GCTAATATCCAGAATCTGCAAGG - Intergenic
911689560 1:100817263-100817285 ACTAATATCCAGAATCTACAAGG + Intergenic
911817984 1:102378616-102378638 GAGGATATTCAAAATGTGCAAGG + Intergenic
911962263 1:104320427-104320449 GCTAATATCCAGAATCTGCAAGG - Intergenic
912081303 1:105940404-105940426 ACTAATATCCAGAATCTACAAGG - Intergenic
912126590 1:106546488-106546510 GCTAATATCCAGAATCTGCAAGG - Intergenic
912148319 1:106822314-106822336 ACTAATATCCAGAATATACAAGG - Intergenic
912180627 1:107215009-107215031 ACTAATATCCAGAATCTACAAGG - Intronic
912261974 1:108119785-108119807 ACAGATGTCCAAAAAGAGCAAGG - Intergenic
912301718 1:108524626-108524648 ACTGATATCCAGAATCTATAAGG - Intergenic
912422559 1:109554590-109554612 ACTAATATCCAGAATCTACAAGG - Intronic
912524923 1:110275120-110275142 ACTGATGTCCAGAATTTACAAGG + Intronic
912639063 1:111326971-111326993 ACTAATATCCACAATATACAAGG - Intergenic
913080402 1:115379822-115379844 ACTAATATCCAGAATCTACAAGG - Intergenic
913132377 1:115852827-115852849 ACTGATATCTAGAATATACAAGG - Intergenic
913236635 1:116790467-116790489 ACTAATATCCAGAATCTACAAGG + Intergenic
913300440 1:117364307-117364329 ACTGGTGCCCAAAATGTACAAGG - Intergenic
913309676 1:117476236-117476258 ACTAATATCCAGAATCTACAAGG - Intronic
913338149 1:117729716-117729738 ACTAATATCCATAATATACAAGG + Intergenic
913402998 1:118456578-118456600 ACTAATATCCAGAATATACAAGG + Intergenic
914286977 1:146236204-146236226 ACTGAGATCCAGACTGTGCCAGG - Intergenic
914348308 1:146818434-146818456 ACTAATATCCAGAATATACAAGG - Intergenic
914548010 1:148686946-148686968 ACTGAGATCCAGACTGTGCCAGG - Intergenic
915058717 1:153161452-153161474 GTTGATATCCAAAATATACAAGG - Intergenic
915767459 1:158378266-158378288 ACTAATATCCAGAATATACAAGG + Intergenic
915800434 1:158786119-158786141 ACTAATATCCAGAATCTACAAGG + Intergenic
915858353 1:159414952-159414974 ACTAATATCCAGAATATACAAGG - Intergenic
916005977 1:160660643-160660665 ACTAATATCCAGAATCTGTAAGG - Intergenic
916277625 1:163012354-163012376 ACTAATATCCAGAATCTACAAGG - Intergenic
916453304 1:164942584-164942606 ACTAATATCCAGAATCTACAAGG - Intergenic
916545867 1:165803821-165803843 GCTAATATCCAAAATCTACAAGG + Intronic
916617830 1:166460993-166461015 GCTAATATCCAAAATATACAAGG - Intergenic
916644961 1:166775205-166775227 ACTAATATCCACAATATACAAGG + Intergenic
916706892 1:167360048-167360070 ACTAATATCCAAAATCTATAAGG - Intronic
916872734 1:168934717-168934739 ACTAATATCCAGAATCTACAAGG - Intergenic
916878255 1:168993515-168993537 ACTAATATCCAGAATCTACAAGG - Intergenic
916917904 1:169429683-169429705 ACTAATATCCACAATCTTCAAGG - Intronic
916978123 1:170103789-170103811 ACTAATATCCAGAATCTACAAGG - Intergenic
917079660 1:171244378-171244400 ACTAATATCCAGAATCTACAAGG + Intergenic
917257366 1:173130154-173130176 ACTAATATCCAGAATCTGCAAGG - Intergenic
917317108 1:173737105-173737127 ACTAATATCCAGAATCTACAAGG - Intronic
917355946 1:174126343-174126365 TCTGATATCCAGAATTTACAAGG - Intergenic
917358261 1:174148853-174148875 GCTGATATCCAGAATCTACAAGG + Intergenic
917484115 1:175439637-175439659 ACTAATATCCAGAATCTACAAGG + Intronic
917643320 1:177005101-177005123 ACTAATATCCAAAATCTACAAGG + Intronic
917698261 1:177552227-177552249 ACTAATATCCATAATATACAAGG - Intergenic
917768113 1:178245452-178245474 ACTGATACCCAGAATCTACAAGG - Intronic
918147475 1:181770285-181770307 CCTGATACCCAAAATGTGGTTGG + Intronic
918167871 1:181968184-181968206 GCTAATATCCAAAATATACAAGG - Intergenic
918173175 1:182018070-182018092 GCTAATATCCAAAATATGTAAGG - Intergenic
918235672 1:182578243-182578265 ATTGATATCCAGAATTTACAAGG + Intronic
918281118 1:183006773-183006795 ACTAATATCCAGAATCTACAAGG - Intergenic
918428171 1:184431731-184431753 GCTAATATCCAGAATGTACAGGG + Intronic
918529789 1:185505676-185505698 ACTAATATCCAGAATCTACAAGG - Intergenic
918555710 1:185797221-185797243 ACTAATATCCAGAATCTACAAGG - Intronic
919141006 1:193571612-193571634 ACTAATATCCAGAATCTACAGGG - Intergenic
919160564 1:193825006-193825028 ACTAATATCCAGAATCTACAAGG + Intergenic
919243968 1:194953075-194953097 ACTAATATCCAGAATCTACAAGG + Intergenic
919293881 1:195669308-195669330 ACTAATATCCAGAATCTACAAGG - Intergenic
919407663 1:197204653-197204675 ACTAATATCCAGAATCTACAAGG - Intergenic
919431101 1:197492763-197492785 ACTAATATCCAGAATCTACAAGG + Intergenic
919485270 1:198138420-198138442 ACTAATATCCAGAATCTACAAGG - Intergenic
920042365 1:203109785-203109807 ACTGATATCCAGAATCTATAAGG + Intronic
920165859 1:204035436-204035458 ACAGCTATCAAAAATGTGCCAGG - Intergenic
920424599 1:205864743-205864765 ACTAATATCCAGAATCTACAAGG + Intergenic
920625500 1:207593721-207593743 ACTAATATCCAGAATCTACAAGG + Intronic
920778350 1:208963284-208963306 ACTAATATCCAGAATATACATGG - Intergenic
920861999 1:209717163-209717185 ACTAATATCCAGAATATACAAGG + Intronic
921001407 1:211047820-211047842 ACTAATATCCAGAATCTACAAGG + Intronic
921535307 1:216342108-216342130 TCTAATATCCAGAATCTGCAAGG + Intronic
921626675 1:217384956-217384978 GCTAATATCCAAAATCTACAGGG + Intergenic
922147549 1:222963041-222963063 ACTAATATCCAGAATCTACAAGG + Intronic
922331150 1:224577319-224577341 ACTAATATCCAGAATCTACAAGG + Intronic
922888498 1:229040628-229040650 ACTCATATCCAGAATCTGTAAGG + Intergenic
923067345 1:230530793-230530815 ACTAATATCCAGAATCTACAAGG + Intergenic
923122651 1:231007648-231007670 ACTAATATCCAGAATCTACAAGG + Intergenic
923174571 1:231451852-231451874 ACTAATATCCAGAATCTGCAAGG + Intergenic
923426948 1:233880188-233880210 ACTAATATCCACAATCTACAAGG - Intergenic
923462710 1:234220993-234221015 CCTTATGTCCTAAATGTGCACGG - Intronic
923657171 1:235927319-235927341 ACTAATATCCAGAATCTACAAGG - Intergenic
923944910 1:238873751-238873773 ACTAGTATCCAGAATTTGCAAGG - Intergenic
923981775 1:239332410-239332432 ACTGTTATCCAAAATATACAAGG + Intergenic
924132206 1:240922481-240922503 ACTGGTATCCACAATATACAAGG + Intronic
924162034 1:241242859-241242881 ACTAATATCCAGAATGTACAAGG - Intronic
924203213 1:241682008-241682030 ACTAATATCCAGAATCTACAAGG - Intronic
924574905 1:245270651-245270673 ATTGATATCTAAAATATACAAGG - Intronic
924649631 1:245913735-245913757 ACTAATATCCAGAATATACAAGG + Intronic
924792134 1:247261277-247261299 GCTAATATCCAAAATATGTAAGG - Intergenic
924831831 1:247604207-247604229 ACTAATATCCAGAATCTACAAGG - Intergenic
924873925 1:248079961-248079983 ATTGATATCCAACATGCACAAGG + Intronic
1062775735 10:145766-145788 ACTGGTATCCAGAATCTACAGGG - Intronic
1062790274 10:299753-299775 GCTAATATCCAGAATGTGTAAGG + Intronic
1063226630 10:4021164-4021186 ACTAATATCCAGAATTTACAAGG - Intergenic
1063247494 10:4237450-4237472 ACTAATATCCAGAATCTACAAGG + Intergenic
1063311319 10:4955350-4955372 ACTGATATCCAGAATTTATAAGG - Intronic
1063316476 10:5011119-5011141 ACTGATATCCAAAATTTATAAGG + Intronic
1063533114 10:6855293-6855315 ACTAATATCCAAAATATGTGAGG - Intergenic
1063837221 10:10029517-10029539 ACTAATATCCAGAATGTGCAAGG + Intergenic
1063852076 10:10203573-10203595 ACTAATATCCAAAATATATAAGG - Intergenic
1064116468 10:12581767-12581789 ACTAAAATCCAGAATCTGCAAGG - Intronic
1064120510 10:12614175-12614197 CCTTATCTCCAAAATGGGCATGG + Intronic
1064305325 10:14160549-14160571 ACTAATATCCAGAATGTTCAAGG + Intronic
1064510916 10:16090457-16090479 ACTAATATCCAGAATCTACAAGG + Intergenic
1064789012 10:18934434-18934456 ACTAATATCCAGAATCTACAAGG - Intergenic
1064853470 10:19737330-19737352 ACTAATATCCAGAATCTACAAGG + Intronic
1064878784 10:20025769-20025791 TCTCATATCCAAAATGTATAAGG - Intronic
1065156556 10:22875572-22875594 ACTGATATCCAAGAAGGGGAGGG - Intergenic
1065156797 10:22878162-22878184 ACTAATATCCTGAATTTGCAAGG - Intergenic
1065272707 10:24051832-24051854 ACTGATATCCAGAATCTACAAGG - Intronic
1065331769 10:24609225-24609247 AGTGAAATTCAAATTGTGCATGG + Intronic
1065381953 10:25099819-25099841 ACTAATATCCAGAATCTACAAGG - Intergenic
1065469520 10:26063022-26063044 ACTGCTATCTAAAATGAGCTAGG + Intronic
1065566997 10:27021663-27021685 ACTAATATCCAGAATATACAAGG - Intronic
1065613280 10:27494320-27494342 ACTAACATCCAGAATGTACAAGG + Intergenic
1065652393 10:27906127-27906149 GCTGATATCCAGAATCTACAAGG + Intronic
1065841657 10:29706531-29706553 TCTAATATCCAAAATCTGCAAGG - Intronic
1066047844 10:31609524-31609546 ACTAATATCCAGAATGTACAAGG - Intergenic
1066070851 10:31809658-31809680 AATGGTATGCAAAATATGCATGG - Intronic
1066143335 10:32529650-32529672 ACTAATATCCAGAATCTACAAGG - Intronic
1066160148 10:32719632-32719654 ACTAATATCCAGAATCTACAAGG + Intronic
1066798213 10:39150224-39150246 AATGAGCTCCAAAATGTCCATGG - Intergenic
1067034952 10:42907830-42907852 ACTGATAACCAGAATCTGCAAGG + Intergenic
1067199301 10:44152740-44152762 CCTAATATCCAAAATCTACAAGG + Intergenic
1067212986 10:44277160-44277182 GCTAATATCCAAAATCTACAAGG + Intergenic
1067252498 10:44599426-44599448 TCTAATATCCAGAATCTGCAAGG + Intergenic
1067256206 10:44644888-44644910 TCTAATATCCAGAATGTACAAGG + Intergenic
1067784333 10:49232531-49232553 ACTAATATCCAGAATTTACAAGG + Intergenic
1067846779 10:49730345-49730367 ACTAATATCCAGAATCTACAAGG + Intergenic
1068011478 10:51456702-51456724 ACTAATATCCAGAATCTACAAGG + Intronic
1068100972 10:52552586-52552608 ACTAATATCCAGAATCTCCAAGG - Intergenic
1068145167 10:53060086-53060108 ACTAATATCCAGAATCTACAAGG - Intergenic
1068184505 10:53567270-53567292 ACTGATATCCAGTATCTACAGGG + Intergenic
1068432845 10:56954891-56954913 ACTAATATCCAGAATCTACAAGG - Intergenic
1068465084 10:57379425-57379447 ACTGATATCCAGAATTTACAAGG + Intergenic
1068553333 10:58430307-58430329 ACTAATATCCAGAATATACAAGG - Intergenic
1068619402 10:59163389-59163411 ATTAATATCCAAAATCTACAAGG - Intergenic
1068750109 10:60582694-60582716 GCTCATATCCAAAATGTAGAAGG - Intronic
1068912368 10:62392125-62392147 ACTAATATCCAGAATCTACAAGG - Intronic
1068924521 10:62521557-62521579 ACTAATATCCAGAATCTACAAGG - Intronic
1069145403 10:64886996-64887018 ACTAATATCCAAAATCTATAAGG - Intergenic
1069273146 10:66555977-66555999 GCTAATATCCAAAATATACAAGG + Intronic
1069386875 10:67891387-67891409 ACAGACACCTAAAATGTGCATGG - Exonic
1070083669 10:73213209-73213231 ACTAATATCCAGAATCTACAAGG - Intronic
1070345163 10:75534574-75534596 ACTGCTTTCCAAAATGTTCTTGG + Intronic
1070434574 10:76377277-76377299 GCTAATATCCAGAATCTGCAAGG - Intronic
1070454170 10:76593389-76593411 ACTAATATCCAGAATCTACAAGG - Intergenic
1070584569 10:77752916-77752938 ATTAATATCCAAAATATACAAGG + Intergenic
1071070909 10:81692732-81692754 ACTAATATCCAGAATCTACAAGG + Intergenic
1071245570 10:83758825-83758847 ACTAATATCCAGAATATTCAAGG + Intergenic
1071801922 10:89073167-89073189 ACTAATATCCAGAATCTACAAGG - Intergenic
1072024296 10:91438956-91438978 GCTAATATCCAAAATCTACAAGG - Intronic
1072380803 10:94867852-94867874 ACTAATATCCAGAATATACAAGG - Intergenic
1072860816 10:99003703-99003725 GTTCATATCCAAAATGTGTAAGG - Intronic
1072868422 10:99089058-99089080 ACTAATATCCAGAATCTACAAGG - Intronic
1072929345 10:99647541-99647563 ACTAATATCCAGAATCTGCAAGG - Intergenic
1073689207 10:105788707-105788729 ACTAATATCCAGAATATGCAAGG + Intergenic
1073734389 10:106328778-106328800 TCTAATATCCAAAATCTACAAGG - Intergenic
1073820621 10:107259365-107259387 ACTAATATCCATAATCTACAAGG + Intergenic
1073827711 10:107344464-107344486 ACTGATATCCAGAATGTATAAGG - Intergenic
1073872697 10:107884037-107884059 ATTGAAACCCAAAATGTGAATGG + Intergenic
1073962271 10:108946130-108946152 TCTAATATCCAAAATCTACAAGG + Intergenic
1074006846 10:109435002-109435024 ACTAATATCCAACATTTACAAGG - Intergenic
1074016288 10:109537494-109537516 ACTAATATCCAGAATCTACAAGG - Intergenic
1074029563 10:109672548-109672570 ACTAGTATCCAGAATCTGCAAGG + Intergenic
1074486385 10:113886983-113887005 GCTAATATCCAAAATATGTAAGG + Intronic
1074629630 10:115237604-115237626 ACTGGTATCCAAATTATACAAGG - Intronic
1074724285 10:116291544-116291566 TCTGATATCCAGAATTTACAAGG - Intergenic
1075000085 10:118790218-118790240 ACTAATATCCAGAATCTACAAGG + Intergenic
1075158139 10:119997803-119997825 ACTAATATCCATAATCTACAAGG - Intergenic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1075494210 10:122905668-122905690 ACTAATATCCAGAATCTACAAGG + Intergenic
1075987701 10:126802099-126802121 ACTAATATCCAGAATTTACAGGG - Intergenic
1076047887 10:127309317-127309339 TCTGATATCCAGAATCTGCAAGG - Intronic
1076211470 10:128649672-128649694 ACTAATATCCAGAATCTGTAAGG + Intergenic
1076211883 10:128655119-128655141 TCTAATATCCAGAATCTGCAAGG + Intergenic
1077427789 11:2493230-2493252 TCTAATATCCAAAATCTACAAGG - Intronic
1077697579 11:4408432-4408454 GCTAATATCCAGAATATGCAAGG + Intergenic
1077714115 11:4564548-4564570 ACTAATATCCAGAATCTACAGGG + Intergenic
1077759806 11:5081521-5081543 ACTAATATCCAGAATATGTAAGG + Intergenic
1077824652 11:5792676-5792698 ACTAATATCCAAAATAAACAAGG - Intronic
1077925339 11:6676649-6676671 GCTGATATCCAAAATATATAAGG + Intergenic
1078121167 11:8510380-8510402 ACTAATATCCAGAATCTACAAGG - Intronic
1078123532 11:8535351-8535373 ACTAATATCCAGAATATACAAGG + Intronic
1078125123 11:8554058-8554080 ATTAATATCCAAAATATGTAAGG + Intronic
1078137908 11:8667465-8667487 ATTGGTATCCAGAATGTGTAAGG + Intronic
1078411571 11:11124654-11124676 ACTAATATCCAGAATCTACAAGG - Intergenic
1078686895 11:13540607-13540629 ACTAATATCCAGAATCTACAAGG - Intergenic
1078982047 11:16546873-16546895 ACTAACATCCAAAATATACAAGG + Intronic
1078988759 11:16623440-16623462 ACTAATATCCAGAATCTACAAGG - Intronic
1079086200 11:17446936-17446958 ACTCATACCAAACATGTGCAAGG + Intronic
1079179903 11:18182560-18182582 ACTAATATCCAGAATCTACAAGG + Intronic
1079400186 11:20100664-20100686 ACTGAGAGCCAAAATGTTCAAGG + Intronic
1079542915 11:21597385-21597407 ACTAATATCCAGAATCTACAAGG + Intergenic
1079596120 11:22249820-22249842 AACCATATCCAAAATCTGCATGG - Intronic
1079634413 11:22717733-22717755 ACTAATATCCAGAATCTACAAGG + Intronic
1079680673 11:23293412-23293434 ACTAATATCCAGAATTTACAAGG + Intergenic
1079712202 11:23699648-23699670 ACTAATATCCAGAATCTACAAGG + Intergenic
1079812874 11:25017152-25017174 ACTAATATCCAGAATCTACAAGG - Intronic
1079833847 11:25306326-25306348 GCTAATATCCAGAATGTACAAGG + Intergenic
1079925332 11:26485954-26485976 ACTGATATCCAGAATTTAAAAGG + Intronic
1079929506 11:26540561-26540583 GCTAATATCCAGAATCTGCAAGG + Intronic
1079973865 11:27068448-27068470 ACTAATATCCAGAATCTACAAGG - Intronic
1080090297 11:28340437-28340459 GCTAATATCCAGAATCTGCAAGG + Intergenic
1080158888 11:29147053-29147075 GTTGATATCCAAAATATACAAGG + Intergenic
1080164427 11:29219869-29219891 TCTAATATCCAGAATTTGCAAGG - Intergenic
1080318359 11:30976444-30976466 GCTGATATCCAGAATATACAAGG + Intronic
1080338231 11:31224619-31224641 ACTAATATCCAGAATCTACATGG + Intronic
1080478557 11:32621774-32621796 GCTAATATCCAGAATTTGCAGGG + Intronic
1080530564 11:33171489-33171511 ACTGTTTTCCAAAGTGTCCAGGG - Intergenic
1080567771 11:33527694-33527716 ACTAATATCCAGAATCTACAAGG + Intergenic
1081463608 11:43295649-43295671 ACTAATATCCAGAATATACAAGG + Intergenic
1081696468 11:45112830-45112852 ACTCATATCCAGAATCTGCAAGG - Intronic
1082119222 11:48359956-48359978 ACTAATATCCAGAATCTACAAGG + Intergenic
1082255077 11:50025191-50025213 ACTAATATCCAGAATCTACAAGG - Intergenic
1082687914 11:56261966-56261988 ACTAATATCCAAAATCTACAAGG + Intergenic
1082721701 11:56685742-56685764 ACTAATATCCAGAATCTACAAGG - Intergenic
1082733912 11:56834934-56834956 AATAATATCCAAAATGTATAAGG - Intergenic
1082871663 11:57948426-57948448 ACTAATATCCAGAATCTACAAGG - Intergenic
1082875822 11:57987380-57987402 TCTGATACCCAAAATATACAAGG - Intergenic
1082886795 11:58093277-58093299 ACTAATATCCAGAATTTACAAGG + Intronic
1082923724 11:58523722-58523744 AATGATATCCAAAATAGGAAGGG + Intergenic
1082955699 11:58867735-58867757 ACTGATATCAAAACTGAGCTAGG + Intronic
1083528059 11:63390054-63390076 CCTAATATCCAGAATGTACAAGG - Intronic
1083530066 11:63412519-63412541 ACTAATATCCAGAATCTACAAGG + Intergenic
1083532963 11:63441599-63441621 GCTAATATCCAAAATCTGCAAGG + Intergenic
1083537656 11:63485887-63485909 ACTAATATCCAAAATCTGCAAGG + Intronic
1084788165 11:71455997-71456019 GCTGACATCCAAAATGAGAAAGG - Intronic
1085955245 11:81385331-81385353 ACTGACATCCAGAATTTACAAGG + Intergenic
1086092458 11:83018571-83018593 ACTAATATCCAGAATCTACAAGG - Intronic
1086207758 11:84280550-84280572 ACTGATTTTTAAAGTGTGCAAGG + Intronic
1086315273 11:85584880-85584902 ACTAATATCCAAAATCTACAGGG - Intronic
1086397052 11:86426458-86426480 ATTAATATCCAAAATATGTAAGG - Intergenic
1086512005 11:87568999-87569021 ACTAATATCCAGAATCTACAAGG + Intergenic
1086819405 11:91416534-91416556 ACTAATATCCAGAATCTACAAGG + Intergenic
1087056846 11:93945167-93945189 ACTGAGATCCAGACTGTGCCAGG + Intergenic
1087135661 11:94716422-94716444 AATAATACCCAAAATGTCCAGGG - Intronic
1087206580 11:95402501-95402523 ACTAATATCCAGAATCTACAAGG - Intergenic
1087219308 11:95528804-95528826 ACTAATATCCAGAATGTACCAGG - Intergenic
1087353651 11:97065791-97065813 ACAAATATCCAGAATGTACAAGG + Intergenic
1087395666 11:97593946-97593968 ACAAATATCCAAAATCTGCAAGG + Intergenic
1087405725 11:97727689-97727711 ACTAATATCCAGAATCTTCAAGG + Intergenic
1087631829 11:100659295-100659317 AGTAATATCCAGAATCTGCAAGG + Intergenic
1087694890 11:101365347-101365369 ACTAATATCCAGAATCTACAAGG - Intergenic
1087912136 11:103766509-103766531 TCTGATATCCAGAATCTGTAAGG - Intergenic
1088157647 11:106828082-106828104 ACTAATAGCCAGAATGTACAAGG - Intronic
1088342501 11:108784569-108784591 TCTAATATCCAGAATCTGCAAGG - Intronic
1088525580 11:110749707-110749729 ACTAATATCCAGAATCTACAAGG - Intergenic
1088634257 11:111804399-111804421 ACTGTTATCCAAAATATACAGGG + Intronic
1088950378 11:114563583-114563605 ACTAATATCCAGAATCTACAAGG + Intergenic
1088958924 11:114640833-114640855 ACTAATATCCAGAATCTACATGG - Intergenic
1089444227 11:118538983-118539005 ATTAATATCCAGAATATGCAAGG - Intronic
1089506714 11:118968209-118968231 TCTGATATCCAGAATCTACAAGG + Intergenic
1089569357 11:119393217-119393239 ACTAATATCCAGAATCTACAGGG - Intergenic
1089820077 11:121217513-121217535 ACTAATATCCAGAATCTACAAGG + Intergenic
1090104002 11:123832205-123832227 ACTAATATCCAGAATCTACAAGG + Intergenic
1090169530 11:124587557-124587579 ACTAATATCCAGAATCTACAAGG + Intergenic
1090180055 11:124689424-124689446 ACTAATATCCAAAATACACAAGG + Intronic
1090589810 11:128253422-128253444 ACTAATATCCAGAATTTACAAGG + Intergenic
1090623804 11:128587212-128587234 ACGGGTATCTAAAACGTGCATGG + Intronic
1090683084 11:129082836-129082858 ACTGATATCCAGAATCTACAAGG + Intronic
1090720097 11:129464285-129464307 ACTAATATCCAGAATATACAAGG + Intergenic
1090754217 11:129774499-129774521 ATTAATATCCAAAATATGTAAGG - Intergenic
1090816881 11:130305858-130305880 ACTAATATCCAGAATCTACAAGG + Intronic
1090877113 11:130800489-130800511 ATTAATATCCAGAATGTACAAGG - Intergenic
1091117608 11:133028976-133028998 ACTAATATCCAGAATCTACAAGG + Intronic
1091388093 12:107856-107878 ACTGATATCCATACTCTGTAAGG - Intronic
1091713307 12:2758122-2758144 ACTAATATCCAGAATCTACAAGG + Intergenic
1092010599 12:5108212-5108234 ACTAATATCCAGAATCTACAAGG - Intergenic
1092059994 12:5540931-5540953 ACTAATATCCAGAATCTACAAGG - Intronic
1092423443 12:8353642-8353664 ACTAATGTCCAGAATCTGCAGGG - Intergenic
1092781255 12:11989639-11989661 ACTAATATCCAGAATATACAAGG - Intergenic
1093251902 12:16816126-16816148 AATAATATCCAAAATGTATAAGG + Intergenic
1093337620 12:17926345-17926367 ACTAATATCCAGAATCTACAAGG + Intergenic
1093456761 12:19372433-19372455 ACTAATATCCAGAATCTGGAAGG - Intronic
1093770895 12:23017296-23017318 ACTGATATCCAGAATCTACAAGG - Intergenic
1093781636 12:23143866-23143888 TCTGATATCCAGAATCTACAAGG - Intergenic
1093818405 12:23579252-23579274 TCTGAAAGCCAAAAAGTGCAAGG + Intronic
1093857001 12:24117073-24117095 ACTAATATCCAAAATATAGAGGG + Intergenic
1093965005 12:25315054-25315076 ACTAATATCCAGAATCTACAAGG + Intergenic
1093978033 12:25444645-25444667 ACTAATATCCAGAATCTACAAGG - Intronic
1094079299 12:26515450-26515472 ACTGACTTCCAGCATGTGCATGG + Intronic
1094158024 12:27358162-27358184 ACTAATATCCAGAATCTACAAGG + Intronic
1094207619 12:27857297-27857319 TCTGATATCCAGAATCTACAGGG - Intergenic
1094379462 12:29827594-29827616 GCTAATATCCAGAATGTACAAGG + Intergenic
1094440387 12:30469505-30469527 ATTGATATCCAGAATATACAAGG - Intergenic
1094446880 12:30540660-30540682 ACTAATATCCAGAATCTACAAGG - Intergenic
1094596240 12:31869368-31869390 TCTGATCACCAAAATGTGTAGGG + Intergenic
1094694068 12:32799026-32799048 ACTAATATCCAGAATCTACAAGG + Intronic
1094778741 12:33764577-33764599 ACTAATATCCAGAATCTACAAGG + Intergenic
1094795660 12:33969162-33969184 ACTGATATCCAGAATATACAAGG + Intergenic
1095119887 12:38404773-38404795 ACTAATATCCAGAATCTACAAGG - Intergenic
1095121234 12:38422400-38422422 ACTAATATCCAGAATCTACAAGG + Intergenic
1095229019 12:39714943-39714965 ACTTATATCCAGAATTTACAAGG - Intronic
1095229885 12:39727044-39727066 GCTAATATCCAGAATCTGCAAGG - Intronic
1095786594 12:46116319-46116341 ACTAATATCCAGAATGTACAAGG + Intergenic
1095807861 12:46340484-46340506 ACTAATATCCAGAATCTACAAGG - Intergenic
1095883068 12:47159615-47159637 ACTAATATCCAGAATATACAAGG - Intronic
1095911897 12:47436028-47436050 ACTAATATCCAGAATATGCAAGG + Intergenic
1096920283 12:55077201-55077223 ACTGATATCTAGCATGTGCTAGG - Intergenic
1097293351 12:57938884-57938906 ACTAATATCCAGAATCTACAAGG + Intergenic
1097609517 12:61801871-61801893 TCTAATATCCAGAATATGCAAGG + Intronic
1097620043 12:61928272-61928294 GCTGATAGCCAGAATGTACAAGG + Intronic
1097620864 12:61937913-61937935 ATTGATATCCAGAATCTACAAGG + Intronic
1097660179 12:62421673-62421695 ACTAATATCCAGAATCTACAAGG + Intergenic
1097833241 12:64247719-64247741 ACTGATATCCAGAATATACAAGG - Intergenic
1097910800 12:64967201-64967223 ACTAATATCCAGAATCTACAAGG + Intergenic
1097965880 12:65580774-65580796 ACTAATATCCAGAATCTACAAGG + Intergenic
1098054534 12:66490726-66490748 TCTAATATCCAAAATCTACAAGG + Intronic
1098058006 12:66528904-66528926 ACTAATATCCAGAATCTGTAGGG + Intronic
1098303001 12:69073473-69073495 ACTAATATCCAGAATCTGCAAGG + Intergenic
1098351882 12:69571451-69571473 TCTGTTATTCAAAATGTGAAAGG - Intronic
1098500038 12:71181431-71181453 ACTAATATCCAGAATCTACAAGG + Intronic
1098551391 12:71765332-71765354 ACTAATATCCAGAATCTACAAGG - Intronic
1098625522 12:72660951-72660973 TCTGATATCCAACATGTGGTTGG - Intronic
1098636958 12:72796169-72796191 TCTAATATCCAAAATTTACAAGG - Intergenic
1098700754 12:73622493-73622515 TCTGATATCCAGAATCTGCAAGG - Intergenic
1098842885 12:75497784-75497806 ACTGTTTTACAAAATGTGCTGGG + Exonic
1098952745 12:76658738-76658760 ACTAATATCCAGAATCTACAAGG + Intergenic
1098999251 12:77158622-77158644 ACTGATATCCAGAATTTACAAGG - Intergenic
1099011068 12:77291805-77291827 ACTAATATCCAGAATCTACAAGG + Intergenic
1099242964 12:80160352-80160374 ACTAATATCCAGAATCTGCAAGG + Intergenic
1099293614 12:80803015-80803037 ACTAATATCCAAAATATGTATGG - Intronic
1099484034 12:83206036-83206058 ACTAATATCCAGAATTTACAAGG + Intergenic
1099526973 12:83727906-83727928 ACTAATATCTAGAATGTACAAGG + Intergenic
1099544868 12:83965954-83965976 ACTAAGATCCAAAATATACAAGG - Intergenic
1099575919 12:84381562-84381584 ACTAATATCCAGAATCTACAAGG - Intergenic
1099587571 12:84540165-84540187 ACTGATATCCAGAATATAAAAGG - Intergenic
1099736225 12:86569296-86569318 ACTAATATCCAAAATTTACAGGG + Intronic
1099759823 12:86905101-86905123 ACTGAGAACCAAAATGTAAAAGG + Intergenic
1099764435 12:86964372-86964394 ACTAATATCCAAAATCTATAAGG - Intergenic
1099878902 12:88442237-88442259 ACTAATATCCAGAATCTACAAGG + Intergenic
1099893880 12:88621099-88621121 ACTAATATCCAGAATCTACAAGG - Intergenic
1100065997 12:90645893-90645915 TCTAATATCCAGAATTTGCAAGG + Intergenic
1100139390 12:91598140-91598162 ACTAATATCCAAAATCTACAAGG - Intergenic
1100169408 12:91957215-91957237 TCTAATATCCAGAATCTGCAAGG + Intergenic
1100176024 12:92031760-92031782 GCTAATATCCAAAATCTACAAGG + Intronic
1100704770 12:97188252-97188274 ACTCATATCCAAAAGCTGTAAGG + Intergenic
1100712687 12:97275119-97275141 AATGATTTCTAAATTGTGCACGG + Intergenic
1100937413 12:99685194-99685216 ACTAATATCCAGAATCTACAAGG + Intronic
1100951732 12:99858147-99858169 ACCAATATCCAAAATTTACAAGG + Intronic
1101183283 12:102243803-102243825 ACTAATATCCAGAATCTACAAGG - Intergenic
1101295101 12:103414364-103414386 ACTGGTATCCAGAATCTGCAAGG - Intronic
1101481094 12:105098131-105098153 ACTAATATCCAGAATCTACAAGG - Intergenic
1102366785 12:112344319-112344341 ACTGAAAACCAAAAACTGCAGGG + Intronic
1102483850 12:113242878-113242900 ACTGAGATCTAAAATGGGCTGGG - Intronic
1103186980 12:118966909-118966931 GCTAATATCCAGAATCTGCAAGG - Intergenic
1104179653 12:126366556-126366578 GCTAATATCCAAAATCTACAAGG - Intergenic
1104332985 12:127865133-127865155 ACTAATATCCAGAATCTACAAGG + Intergenic
1104343622 12:127975877-127975899 ACTAATATCCAGAATCTACAAGG - Intergenic
1104650441 12:130527704-130527726 TCTGATATCCAGAATCTACAAGG + Intronic
1104803492 12:131570397-131570419 ACTGATCTCCAAGATGGACAGGG - Intergenic
1105598463 13:21862361-21862383 ACTAATATCCAAAATCTACAAGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105989969 13:25609993-25610015 ACTAATATCCAGAATCTGCAAGG - Intronic
1106410521 13:29508141-29508163 CTTCATAACCAAAATGTGCAAGG + Intergenic
1106731328 13:32544381-32544403 ACTAATATCCAGAATATACAAGG + Intergenic
1106830678 13:33578761-33578783 ACTTATATCCAGAATCTACAAGG + Intergenic
1106894539 13:34284855-34284877 ACTAATATCCAGAATCTACAAGG + Intergenic
1107297376 13:38924779-38924801 ACTAATATCCAGAATATACAAGG + Intergenic
1107502616 13:40995945-40995967 ACTGTTATCTAAAATATGCAAGG + Intronic
1107510494 13:41079071-41079093 ACTAATATCCAGAATCCGCAAGG + Intronic
1108307073 13:49148098-49148120 ACTAATATCCAGAATATACAAGG - Intronic
1108391195 13:49949464-49949486 ACTAATATCCAGAATCTACAAGG + Intergenic
1108762366 13:53584048-53584070 ACTAATATCCAGAATCTACAAGG - Intergenic
1108836258 13:54553426-54553448 ACTAATATCCAGAATCTACAAGG - Intergenic
1109021947 13:57108056-57108078 ACTAATATCCAGAATCTACAAGG + Intergenic
1109033354 13:57222729-57222751 ACTAATATCCAGAATCTGCAAGG + Intergenic
1109035189 13:57249344-57249366 ACTAATATCCAGAATTTCCAAGG + Intergenic
1109057942 13:57576235-57576257 ACTAATATCCAGAATCTACAAGG - Intergenic
1109366988 13:61368540-61368562 GCTAATATCCAGAATCTGCAAGG + Intergenic
1109420139 13:62100874-62100896 ACTAATATCCATAATCTACAAGG - Intergenic
1109596699 13:64565426-64565448 ACTAATATCCAGAATCTACAAGG - Intergenic
1109612534 13:64785790-64785812 ACTAATATCCAGAATCTACAAGG + Intergenic
1109617823 13:64859917-64859939 ACTAATATCCAGAATCTACAGGG - Intergenic
1109652366 13:65346017-65346039 ACTAATATCCAGAATCTGTAAGG + Intergenic
1109817501 13:67604492-67604514 GCTAATATCCAGAATCTGCAAGG - Intergenic
1109968573 13:69736149-69736171 ACTAATATCCAGAATCTACAAGG + Intronic
1110020441 13:70462664-70462686 GCTGATATCCAGAATGTACAAGG + Intergenic
1110245187 13:73315512-73315534 ATTGATATCCAGAATATGTAAGG + Intergenic
1110398408 13:75060428-75060450 ACTAATATCCAGAATATACAAGG + Intergenic
1110418902 13:75282500-75282522 ACTAATATCCAGAATCTACAAGG - Intergenic
1110461793 13:75753287-75753309 ACTGATATCCAGAATTTATAAGG - Intronic
1110476669 13:75923227-75923249 ACTAATGTCCAAAACGTACAAGG + Intergenic
1110505025 13:76275725-76275747 ACTAATATCCAGAATCTACAAGG + Intergenic
1110570513 13:76997494-76997516 ACTAATATCCAGAATCTACAAGG - Intronic
1110629278 13:77688056-77688078 ACTGTTATCCAGAATTTACAAGG + Intergenic
1110639439 13:77805110-77805132 ACTAATATCCAGAATCTACAAGG - Intergenic
1110685762 13:78372215-78372237 ACTAATATCTAGAATCTGCAAGG - Intergenic
1110736989 13:78948689-78948711 ACTCATATCCAGAATTTACAAGG - Intergenic
1110982719 13:81921636-81921658 ACTGACATCCCAAATAAGCAGGG - Intergenic
1111021104 13:82453711-82453733 ACTAATATCCAGAATCTACAAGG + Intergenic
1111164600 13:84442571-84442593 ACTAATATCCAGAATCTACAAGG - Intergenic
1111193016 13:84833789-84833811 ACTAATATCCAGAATGTACAAGG - Intergenic
1111518117 13:89362230-89362252 AGTGAAGTCCAAATTGTGCAAGG - Intergenic
1112021568 13:95376121-95376143 ACTAATATCCAGAATCTACAAGG + Intergenic
1112250709 13:97776547-97776569 ACTAATATCCAGAATCTACAAGG - Intergenic
1112377085 13:98853158-98853180 AATGAGTTCCAAAATGTGAATGG - Intronic
1112696996 13:101961065-101961087 TCTAATATCCAGAATGTACAAGG - Intronic
1112748909 13:102560335-102560357 ACTAATATCCAGAATCTACAAGG - Intergenic
1112879295 13:104086083-104086105 ACTAATATCCATAATCTACAAGG + Intergenic
1113046792 13:106164761-106164783 GCTAATATCCAGAATCTGCAAGG - Intergenic
1113534500 13:111053972-111053994 ACTAATATCCAGAATCTACAAGG - Intergenic
1113637718 13:111931703-111931725 ACTAATATCCAGAATCTACAAGG - Intergenic
1114203423 14:20544680-20544702 ACTTATATCCAGAATCTACAAGG - Intergenic
1114279824 14:21182123-21182145 ACTAATATCCAGAATCTACAAGG - Intergenic
1114343042 14:21765389-21765411 ACTAATATCCAGAATCTACAAGG + Intergenic
1114374968 14:22135010-22135032 GCTAATATACAAAATATGCAAGG + Intergenic
1114387984 14:22275094-22275116 ACTAATATCCAGAATCTACAAGG - Intergenic
1114396538 14:22368114-22368136 ACTAACATCCAAAATCTACAGGG + Intergenic
1114545912 14:23500795-23500817 ACTAATATCCAGAATCTACAAGG - Intronic
1114691170 14:24583239-24583261 ACTAATATCCAGAATATACAAGG - Intergenic
1114932374 14:27489732-27489754 ATTAATATCCCAAATGTACAAGG + Intergenic
1114952313 14:27770635-27770657 ACTAATATCCAAAACCTACAAGG + Intergenic
1115740321 14:36380804-36380826 ACTCATATCCAGAATCTACAAGG + Intergenic
1115744749 14:36425044-36425066 ACTGATTTCCAAAATGTTAGAGG - Intergenic
1115947640 14:38680386-38680408 ACTAATATCCAGAATCTGCAAGG - Intergenic
1115956194 14:38782620-38782642 GCTAATATCCAAAATATGTAAGG + Intergenic
1116038042 14:39652699-39652721 GCTGATATCCAAAATATGTAAGG + Intergenic
1116226402 14:42158842-42158864 ACTGATATCCAGAATTTACAAGG + Intergenic
1116262199 14:42644767-42644789 GCTAATATCCAAAGTGTACAAGG - Intergenic
1116274684 14:42817215-42817237 ACTAATATCCAAAACATACAAGG + Intergenic
1116354012 14:43904721-43904743 GCTAATATCCAGAATCTGCAAGG - Intergenic
1116406512 14:44573221-44573243 ACTAATATCCAGAATCTACAAGG + Intergenic
1116417670 14:44698295-44698317 GCTGATATCCAGAATCTACAAGG + Intergenic
1116485853 14:45447337-45447359 ACTAATATCCAGAATATACAAGG - Intergenic
1116584394 14:46684309-46684331 ACTCATGTCCAGAATGTACAAGG - Intergenic
1116685249 14:48031019-48031041 TCTAATATCCAGAATCTGCAAGG - Intergenic
1116747384 14:48837975-48837997 ACTAATATCCAGAATATGCAAGG + Intergenic
1116753674 14:48918961-48918983 ACTGCTATCCAGAATTTACAAGG + Intergenic
1116754715 14:48932648-48932670 ACTAATATCCAGAATCTACAAGG + Intergenic
1116785128 14:49279878-49279900 ATTAATTTCCAAAATGTGTAAGG - Intergenic
1116928047 14:50661327-50661349 ACTAATATCCAGAATATGCAAGG - Intronic
1116955417 14:50917948-50917970 ACTAATATCCAGAATCTACAAGG + Intronic
1117716200 14:58584093-58584115 ACTTGTACCCAATATGTGCAAGG + Intergenic
1118043785 14:61944999-61945021 GCTAATATCCAGAATGTACAAGG + Intergenic
1118101517 14:62610128-62610150 ACTAATATCCAGAATCTACAAGG + Intergenic
1118140992 14:63082413-63082435 ACTAATATCCAGAATATACAAGG + Intronic
1118653613 14:67924107-67924129 ACTAATATCCAGAATCTACAAGG - Intronic
1119607129 14:76029340-76029362 ACTAATATCCAAAATCTATAAGG - Intronic
1119858561 14:77919963-77919985 ACTAATATCCAGAATCTACAAGG - Intronic
1120224011 14:81769827-81769849 ACTGATATCCAGAAGCTACAGGG + Intergenic
1120514094 14:85449901-85449923 GCTGATATCCAGAATCTACAAGG + Intergenic
1121749576 14:96338895-96338917 ACTAATATCCAGAATCTACAAGG + Intronic
1121784267 14:96643642-96643664 ACTAATATCCAGAATATGCAAGG - Intergenic
1122395883 14:101429945-101429967 TCTGATATCCAGAATCTACAAGG - Intergenic
1122589932 14:102841370-102841392 ACTGATGTCCAAGAAGTGCTTGG - Intronic
1122821998 14:104352241-104352263 ACTCACATCCAAAATATACAAGG - Intergenic
1123099775 14:105789477-105789499 ACTAATATCCAGAATCTACAAGG + Intergenic
1123102806 14:105817190-105817212 ACGAATGTCCAAAATCTGCAGGG - Intergenic
1123791109 15:23721467-23721489 GTTGATATCCAAAATATACAAGG - Intergenic
1123885402 15:24722195-24722217 GCTAATATCCAAAATCTACAAGG + Intergenic
1123980262 15:25595813-25595835 ACTGATCTCCCAAATATGCATGG - Intergenic
1124178620 15:27451796-27451818 GTTGATATCCAAAATATGAAAGG + Intronic
1124478011 15:30052496-30052518 ACTAATATTCAGAATGTACAAGG - Intergenic
1125124517 15:36204266-36204288 GTTAATATCCAAAATGTGTAAGG + Intergenic
1125145406 15:36461673-36461695 ACTAATATCCAGAATTTACAAGG - Intergenic
1125367883 15:38938858-38938880 ACTAATATCCAGAATCTACAAGG + Intergenic
1125370341 15:38969062-38969084 ACTAATATCCAGAATCTACAAGG + Intergenic
1125456459 15:39864800-39864822 ACTAATATCCAGAATTTACAAGG + Intronic
1125552863 15:40560479-40560501 ACTAATATCCAGAATCTACAAGG + Intronic
1126221112 15:46214604-46214626 ACTAATATCCAGAATCTACAAGG + Intergenic
1126245043 15:46495003-46495025 ACTAATATCCAGAATCTACAAGG + Intergenic
1126279512 15:46928079-46928101 ATTGATATCCATAATTTACAAGG - Intergenic
1126286284 15:47015392-47015414 ACTGATATCCAAAATCTACAGGG - Intergenic
1126386967 15:48103427-48103449 ATGGATATCCAAAATATGGATGG - Intergenic
1126489496 15:49220962-49220984 ACTAATATCCAAAATATACAAGG - Intronic
1126504489 15:49388747-49388769 ACTAGTATCCAGAATGTACAAGG + Intronic
1126528167 15:49681484-49681506 ACTAATATCCAGAATCTACAAGG + Intergenic
1126566335 15:50104340-50104362 ACTAATATCCAGAATCTACAAGG + Intronic
1126609915 15:50518923-50518945 ACTAATATCCAGAATATACAAGG + Intronic
1126642885 15:50845478-50845500 ACTGATATCCAGAATCTACAAGG + Intergenic
1126659541 15:51018884-51018906 ACTAATATCCAGAATATACAAGG - Intergenic
1127013343 15:54654750-54654772 ATTGATATCCAGAATTTACAAGG + Intergenic
1127022375 15:54762592-54762614 ACTAATATCCAGAATCTACAAGG + Intergenic
1127034782 15:54903788-54903810 ACTGATATCTAGAATTTACAAGG + Intergenic
1127090746 15:55464565-55464587 ACTAATATCCACAATGTACAGGG + Intronic
1127222809 15:56898273-56898295 TCTAATATCCAAAATTTACAAGG + Intronic
1127226521 15:56936359-56936381 ACTAATATCCAGAATCTACAAGG - Intronic
1127505960 15:59598023-59598045 ACTAATATCCACAATATACAAGG - Intronic
1128481276 15:68041719-68041741 ACTAATATCCAGAATATACAAGG + Intergenic
1128617287 15:69120177-69120199 ATTGATATCCAAAATAGCCACGG - Intergenic
1128852022 15:70968861-70968883 ACTAATATCCAGAATCTACAAGG - Intronic
1128965701 15:72055577-72055599 ACTAATATCCAGAATCTACAAGG + Intronic
1129046731 15:72742038-72742060 ACTAATATCCAGAATCTACAAGG + Intergenic
1129632324 15:77274383-77274405 ACTAATATCCAGAATCTACAAGG + Intronic
1130405775 15:83600071-83600093 ACTAATATCCAGAATCTACAAGG - Intronic
1130692687 15:86098191-86098213 ACTAATATCCAGAATATACAAGG - Intergenic
1130722374 15:86401331-86401353 ACTAATATCTAAAATCTACAAGG - Intronic
1130723498 15:86413752-86413774 ACTAATATCCAGAATTTACAAGG - Intronic
1130749342 15:86693481-86693503 ACTAATATCCAGAATCTACAAGG - Intronic
1131389946 15:92039339-92039361 TCTGATATCCAGAATCTACAAGG + Intronic
1131452585 15:92557700-92557722 GCTAATATACAAAATATGCAAGG + Intergenic
1131608354 15:93933790-93933812 ATGCAAATCCAAAATGTGCAAGG + Intergenic
1131608992 15:93941151-93941173 ACTGAAATGCAAAATGTAAATGG - Intergenic
1131634666 15:94218903-94218925 TCTAATATCCAAAATCTACAAGG + Intergenic
1131660507 15:94510503-94510525 ATTAATATCCAAAATATACAAGG + Intergenic
1131729932 15:95268825-95268847 AATCATATCCGAAATGGGCAGGG + Intergenic
1132173178 15:99684584-99684606 ACTAATATCCAGAATCTACAAGG - Intronic
1132264370 15:100454828-100454850 ACTAATATCCAGAATATACAGGG + Intronic
1133383325 16:5349025-5349047 AATCCCATCCAAAATGTGCAGGG + Intergenic
1133419457 16:5633517-5633539 ACTGACATCCAGAATCTACAAGG + Intergenic
1133696374 16:8266959-8266981 ACTAATATCCAGAATCTACAAGG - Intergenic
1135090630 16:19512441-19512463 ACTAATATCCAGAATATACAAGG - Intronic
1135795496 16:25437591-25437613 ACTAATATCCAGAATCTACAAGG - Intergenic
1135968234 16:27053009-27053031 ACAGATTTCTAAAATCTGCATGG - Intergenic
1136668847 16:31837971-31837993 ACTAATATCCAGAATTTACAAGG + Intergenic
1136729406 16:32394392-32394414 ACTAATATCCAAAATCTATAAGG - Intergenic
1136928909 16:34400874-34400896 ACTAATATCCAGAATCTACAAGG - Intergenic
1136975665 16:35010930-35010952 ACTAATATCCAGAATCTACAAGG + Intergenic
1137510088 16:49091675-49091697 ACTAATATCCAGAATCTACAAGG + Intergenic
1137643198 16:50051605-50051627 ACTAATATCCAGAATATACAAGG + Intergenic
1137643201 16:50051629-50051651 ACTAATATCCAGAATATACAAGG + Intergenic
1138035010 16:53595318-53595340 ACTAATATCCAGAATCTACAAGG - Intergenic
1138632052 16:58304695-58304717 ACTAATATCCAGAATCTACAAGG - Intronic
1138755740 16:59482293-59482315 ACTCATATCCAGAATATACAAGG - Intergenic
1138781958 16:59799200-59799222 ACTAATATCCAGAATCTACAAGG - Intergenic
1138792770 16:59927161-59927183 CCTAATATCCAAAATCTGTAAGG - Intergenic
1138845588 16:60561584-60561606 ACTAATATCCAGAATCTACAAGG - Intergenic
1139063170 16:63280401-63280423 ACTAATATCCAGAATCTACAAGG + Intergenic
1139090160 16:63635769-63635791 ACTAATATCCAGAATCTACAAGG - Intergenic
1139419238 16:66839523-66839545 ACTAATATCCAGAATCTACAAGG + Intronic
1139985729 16:70897111-70897133 ACTAATATCCAGAATATACAAGG + Intronic
1140182245 16:72731558-72731580 TCTAATATCCAAAATCTACAAGG - Intergenic
1140272815 16:73481795-73481817 ACTGACATCTAAAATGTGGTAGG - Intergenic
1140543596 16:75784207-75784229 GCTCATATCCAAAATATACAAGG - Intergenic
1140964891 16:79956111-79956133 ACTGGTATACTAAATCTGCATGG + Intergenic
1141060837 16:80867692-80867714 ACTAATATCCAGAATCTACAAGG + Intergenic
1141071584 16:80960955-80960977 ACTAGTATCCAAAATGTACAAGG + Intergenic
1141238045 16:82238612-82238634 ACTAATATCCAGAATCTACAAGG - Intergenic
1202996987 16_KI270728v1_random:122901-122923 ACTAATATCCAAAATCTATAAGG + Intergenic
1203023674 16_KI270728v1_random:435243-435265 ACTAATATCCAAAATCTATAAGG + Intergenic
1142946199 17:3430543-3430565 TTTAATATCCAAAATGTACAAGG + Intergenic
1143935551 17:10480886-10480908 GCTAATATCCAAAATGTAAAAGG - Intergenic
1144217663 17:13070615-13070637 ACTGAAATCCAAAAAATTCAGGG + Intergenic
1144376067 17:14643218-14643240 ACTAATATCCAGAATCTACAAGG + Intergenic
1145413940 17:22697210-22697232 AGTAATATGCAGAATGTGCAGGG - Intergenic
1145723755 17:27097518-27097540 ACTAATATCCAGAATCTACAAGG - Intergenic
1146742169 17:35296282-35296304 GCTAATATCCAAAATATACAAGG + Intergenic
1147053026 17:37811565-37811587 ACTAATATCCAAAATCTACAAGG - Intergenic
1148031113 17:44621754-44621776 AGTGAGATCCAAATTCTGCAGGG + Intergenic
1148120171 17:45204406-45204428 ACTAATATCCCAAATCTGCAAGG - Intergenic
1148284792 17:46378609-46378631 ACTGATATCCAGAACATACAAGG - Intergenic
1148307013 17:46596531-46596553 ACTGATATCCAGAACATACAAGG - Intronic
1148398508 17:47331150-47331172 ACTAATATCCAGAATTTACAAGG - Intronic
1149077430 17:52612811-52612833 ACTGAAATACTAAATGAGCAGGG + Intergenic
1149090146 17:52768355-52768377 ACTGATATCCACAATCCACAAGG + Intergenic
1149131630 17:53309236-53309258 GCTAATATCCAAAATCTACAAGG + Intergenic
1149257793 17:54846877-54846899 ACTGATAACAAAAACCTGCAAGG + Intergenic
1149463421 17:56853171-56853193 ACTAATCTCCAAAATGTAGAAGG - Intronic
1149716730 17:58798149-58798171 ACTGATATTCAGAATGTGTTAGG - Intronic
1150534792 17:66025391-66025413 ACTGATATCCAGAATTTACAAGG + Intronic
1150948340 17:69773061-69773083 TCTGATATTCAAAATCTGTAAGG + Intergenic
1153178080 18:2402041-2402063 ACTAATATCCAAAATATACAAGG + Intergenic
1153391841 18:4570857-4570879 ACTAATATCCAGAATATACAAGG - Intergenic
1153450949 18:5228008-5228030 ACTAATATCCAGAATCTACAAGG - Intergenic
1153462282 18:5349514-5349536 TCTAATATCCAAAATGTGTAAGG + Intergenic
1153506851 18:5809484-5809506 ACTAATATCCAGAATTTACAAGG - Intergenic
1153556583 18:6321341-6321363 ACTAATATCCAGAATCTACAAGG + Intronic
1153573756 18:6499843-6499865 ACTGATATCCAGAATCTACAAGG - Intergenic
1153703343 18:7718674-7718696 ACTAATATCCAGAATCTACAAGG + Intronic
1154298356 18:13171107-13171129 ACTAATATCCAGAATCTACAAGG + Intergenic
1155047967 18:22120103-22120125 ACTAATACCCAAAATATACAAGG - Intergenic
1155225659 18:23726969-23726991 ACTAATATCCAGAATCTACAAGG - Intronic
1155665953 18:28308485-28308507 ACTGCTATCCAGAATTTACAAGG + Intergenic
1155708313 18:28843938-28843960 ACTAATATCCAGAATCTACAAGG - Intergenic
1155776998 18:29777266-29777288 ACTGATATCCAGAATCTATAAGG - Intergenic
1155887244 18:31223216-31223238 ACTAATATCCAGAATCTACAAGG + Intergenic
1156279018 18:35614736-35614758 ACTAACATCCAGAATCTGCAAGG + Intronic
1156425196 18:37003448-37003470 ACTCATATCCAGGATGTTCAAGG + Intronic
1156425276 18:37004368-37004390 ACTAATATCCAGAATCTACAGGG + Intronic
1156667905 18:39430530-39430552 ACTAATATCCAGAATCTACAAGG + Intergenic
1156731803 18:40203410-40203432 ACTGATATCCAGAGAGGGCAAGG + Intergenic
1157171027 18:45405249-45405271 TCTGATATCCAAAAAGCACAGGG + Intronic
1157240144 18:46001479-46001501 ACTAATATCCAAAATACACAAGG - Intronic
1157549548 18:48571957-48571979 TCTTAAATCCAAAATCTGCAAGG + Intronic
1157976242 18:52330477-52330499 ATTGATTTCCAAAATGGGAAAGG - Intergenic
1158787028 18:60726352-60726374 ACTAATATCCAGAATCTACAAGG - Intergenic
1158792880 18:60803493-60803515 TCTAATATCCAGAATCTGCAAGG + Intergenic
1159180831 18:64902117-64902139 ACTAATATCCAGAATCTACAAGG + Intergenic
1159263189 18:66043057-66043079 ACTAATATCCAGAATCTACAAGG - Intergenic
1159281611 18:66292995-66293017 GCTAATATCCAAAATCTACAAGG - Intergenic
1159760173 18:72416056-72416078 TCTAATATCCAGAATTTGCAAGG + Intergenic
1160267090 18:77348043-77348065 ACTAATATCCAGAATCTACAAGG - Intergenic
1162615149 19:11793616-11793638 ACTAATATCCAGAATATACAAGG - Intergenic
1162632120 19:11936567-11936589 ACTAATATCCAGAATCTACAAGG - Intronic
1163990360 19:20993476-20993498 TCTAATATCCAAAATCTACAAGG + Intergenic
1164144543 19:22504058-22504080 ACTAATATCCAAAATCTACAAGG + Intronic
1164319650 19:24132019-24132041 ACTAATATCCAGAATCTACAAGG - Intergenic
1164442017 19:28285778-28285800 ACTAATATCCAGAATCTACAAGG - Intergenic
1164545696 19:29160634-29160656 ATTAATATCCAGAATCTGCAAGG + Intergenic
1164664847 19:30021934-30021956 ACTAATATCCAGAATCTACAAGG - Intergenic
1165182444 19:33984148-33984170 ACTGATAACAAAATTTTGCAAGG + Intergenic
1165537070 19:36457430-36457452 GCTAATATCCAAAATGTATAAGG + Intronic
1165681100 19:37776746-37776768 ACTGACATCCAGAATCTACAAGG + Intronic
1165983022 19:39741429-39741451 ACTAATATCCAGAATCTACAAGG - Intergenic
1166426015 19:42678672-42678694 ACTAATATCCAGAATCTACAAGG - Intronic
1167519314 19:49943809-49943831 ACTAATATCCAGAATATACAAGG + Intronic
1167871811 19:52376866-52376888 ACTAATATCCAGAATCTACAAGG - Intronic
1168175065 19:54621568-54621590 ACTAATGTCCAGAATCTGCAAGG - Intronic
1168302238 19:55412040-55412062 ACTAATATCCAGAATTTACAAGG + Intergenic
925053825 2:839831-839853 TCTAATATCCAGAATCTGCAAGG + Intergenic
925074395 2:1002364-1002386 ACTAATATCCAGAATCTACAAGG + Intronic
925095797 2:1200633-1200655 ACTAATATCCAGAATATACAAGG + Intronic
925110710 2:1334054-1334076 ACTAATATCCAGACTCTGCAAGG + Intronic
925252279 2:2449964-2449986 ACTAATATCCAGAATCTACAAGG - Intergenic
925268498 2:2584228-2584250 TCTAATATCCAGAATGTACAAGG + Intergenic
925446721 2:3932611-3932633 ACTAATATCCAAAATCTACAAGG - Intergenic
925558912 2:5166515-5166537 TCTAATATCCAAAATCTACAAGG + Intergenic
925637551 2:5955207-5955229 ACCAATATCTAAAATGTACAAGG - Intergenic
925706475 2:6688577-6688599 ACTAATATCCAGAATCTACAAGG + Intergenic
925743050 2:7021675-7021697 ACTCAAATCCAATATGTCCAGGG - Intronic
926235109 2:11035477-11035499 ACTTATATCCAGAATCTACAAGG - Intergenic
926454323 2:13045559-13045581 TCTAATATCCAAAATCTACAAGG + Intergenic
926708254 2:15852640-15852662 ACTAATATCCAGAATATACAAGG - Intergenic
926804633 2:16695822-16695844 ACTAATATCCAGAATCTACAGGG - Intergenic
926869196 2:17393646-17393668 ACTAATATCTAAAATCTACAAGG + Intergenic
926967261 2:18428797-18428819 ACTGAGATCTAAAATGAGCTGGG + Intergenic
926990141 2:18670429-18670451 ACTAATATCCAGAATCTACAAGG - Intergenic
927006635 2:18857164-18857186 TCTAATATCCAGAATCTGCAAGG - Intergenic
927273267 2:21237684-21237706 TCTGAAGTCCAAAATCTGCAGGG - Intergenic
927752259 2:25679839-25679861 ACTTATATCCAAAATATATAAGG + Intergenic
928067482 2:28180727-28180749 ACTAATATCCAAAATATGCGAGG + Intronic
928083582 2:28331432-28331454 TCTAATATCCAAAATCTACAAGG + Intronic
928184658 2:29099079-29099101 ACTGTTATCCAAAATATACAAGG - Intronic
928282437 2:29960550-29960572 TCTAATATCCAGAATCTGCAAGG + Intergenic
928473390 2:31597567-31597589 ACTGATATCCAGAAACTACAAGG + Intergenic
928479737 2:31669985-31670007 ACTAATATCCAGAATCTACAAGG - Intergenic
928627205 2:33152180-33152202 ACTAATATCCAGAATCTACAAGG + Intronic
928655891 2:33451287-33451309 ACCAATATCCAAAATATGTAAGG - Intronic
928752830 2:34490847-34490869 ACTAATATCCAGAATATACAAGG + Intergenic
928793116 2:34982506-34982528 ACTGATATCCAGAATCTACCAGG - Intergenic
928851058 2:35747570-35747592 ACTGATATCCAAAACAGGCAAGG + Intergenic
928882313 2:36111083-36111105 ACTGATATCCAGAATGTACAGGG - Intergenic
929319802 2:40529281-40529303 ACTAATATCCAGAATCTACAAGG - Intronic
929373683 2:41258260-41258282 CCTGAAATTGAAAATGTGCAAGG - Intergenic
929385087 2:41396807-41396829 ATTAATATCCAGAATATGCAAGG - Intergenic
929636954 2:43533001-43533023 TCTAATATCCAGAATCTGCAAGG + Intronic
929637130 2:43535214-43535236 ATTAATGTCCAAAATGTACAGGG - Intronic
929734882 2:44537275-44537297 ACTAATATCCAGAATATACAAGG + Intronic
930149278 2:48041939-48041961 TCTGATATCCAGAGTCTGCAAGG - Intergenic
930159601 2:48141036-48141058 ACTAATATCCAGAATCTACAAGG - Intergenic
930474622 2:51865603-51865625 ACTAATATCCAAAATCTACTAGG - Intergenic
930539382 2:52686069-52686091 ACTGATATCTAAATTCTACAAGG + Intergenic
930617947 2:53613677-53613699 ACTAATATCCAGAATATACAAGG - Intronic
930775292 2:55164807-55164829 ACTGGTTTCCAAAATGTTCTGGG + Intergenic
931134519 2:59382137-59382159 ACTAATATCTAAAATATACAAGG + Intergenic
931497899 2:62830525-62830547 ACTAATACCCAAAATCTACAAGG - Intronic
931644258 2:64407135-64407157 ACTAATATCTAGAATATGCAAGG + Intergenic
931815371 2:65895510-65895532 GCTAATATCCAGAATGTGCAAGG + Intergenic
931828870 2:66029795-66029817 ACTAATATCCAGAATCTACAAGG - Intergenic
931835065 2:66090501-66090523 ACTAATATCCAGAATCTACAAGG + Intergenic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
931919491 2:66997749-66997771 ACTGATATCCAGAATCTATAAGG - Intergenic
932089549 2:68793154-68793176 ACTAATATCCAGAATCTACAAGG - Intronic
933053914 2:77637173-77637195 ACTAATATCCAGAATGTACAAGG - Intergenic
933083287 2:78022187-78022209 ACTAATATTCAGAATATGCAAGG - Intergenic
933148392 2:78884752-78884774 TCTAATATCCAAAATCTACAAGG + Intergenic
933222088 2:79702069-79702091 CCTGATACCCAAAATAAGCATGG + Intronic
933340594 2:81020821-81020843 ACTAATATCCAGAATCTGCAAGG - Intergenic
933360057 2:81270408-81270430 ACTAATATCCAGTATGTACAAGG + Intergenic
933398316 2:81760035-81760057 ACTAATATCCACAATCTGCAAGG + Intergenic
933412724 2:81946062-81946084 GCTAATATCCAGAATCTGCAAGG - Intergenic
933474737 2:82775750-82775772 ACTAATATCCAGAATCTACAAGG + Intergenic
933475710 2:82787864-82787886 ACTCATATCCAGAATTTACAAGG + Intergenic
933494641 2:83033904-83033926 ACTAATATCCAGAATCTACAAGG - Intergenic
933627248 2:84614900-84614922 ACTAATAGCCAGAATCTGCAAGG - Intronic
934020291 2:87943518-87943540 ACTGATATCCAGAGTATACAAGG - Intergenic
934043888 2:88154819-88154841 ATTGATATCCAGAATATACAAGG + Intergenic
934485001 2:94698672-94698694 ACTAATATCCAAAACCTACAAGG - Intergenic
935003145 2:99041934-99041956 AATAATATCCAGAATGTACAAGG + Intronic
935007528 2:99094512-99094534 ACTAATATCCAGAATCTACACGG + Intronic
935260667 2:101353135-101353157 TCTAATATCCAAAATCTACAAGG - Intronic
935476866 2:103533077-103533099 ACTAATATCCAGAATCTACAAGG - Intergenic
935859084 2:107308283-107308305 ACTAATATCCAAAATATACAAGG - Intergenic
936003452 2:108859277-108859299 ACTAATATCCAGAATCTACAAGG - Intronic
936442267 2:112564826-112564848 AGTAATATTCAAAATATGCAAGG + Intronic
936633533 2:114230517-114230539 ACTAATATCCAGAATGTACAAGG - Intergenic
936749802 2:115628397-115628419 TCTAATATCCAAAATTTACAAGG - Intronic
936766436 2:115854645-115854667 ACTCATATCCAGAATATACAAGG - Intergenic
936894774 2:117414659-117414681 ACTAATATCCAGAATCTACAAGG - Intergenic
937461098 2:122086819-122086841 ACTAATATCCAAAATCTACGAGG - Intergenic
937498983 2:122457179-122457201 ACTAATATCCAGAATTTGTAAGG + Intergenic
937699134 2:124843886-124843908 ACTAATATCCAGAATCTACAAGG - Intronic
937752359 2:125491609-125491631 ACTAATATCCAGAATCTACAAGG - Intergenic
937761939 2:125615177-125615199 ACTAATATCCAGAATCTACAAGG - Intergenic
937798526 2:126053858-126053880 ACTAATATCCAGAATCTACAAGG - Intergenic
937947842 2:127356986-127357008 ACTAATATCCAGAATCTACAAGG + Intronic
937972034 2:127558107-127558129 ACTAATATCCAGAATCTACAAGG + Intronic
938147030 2:128843475-128843497 ACTGATATCCAGAATTTATAAGG - Intergenic
938470134 2:131552394-131552416 ACTAATATCCAGAATCTACAAGG - Intergenic
938944598 2:136200231-136200253 ACTGATATGCAATATATGCTGGG + Intergenic
938947800 2:136229145-136229167 ACTAATATCCAGAATCTACAAGG + Intergenic
939097137 2:137845966-137845988 ATTCATATCCAAAATATGTAAGG - Intergenic
939188826 2:138891478-138891500 GCTAATATCCAGAATATGCAAGG + Intergenic
939219731 2:139286513-139286535 ACTAATATCCAAAATCTACAAGG + Intergenic
939245415 2:139617387-139617409 ACTAATATCCAGAATCTACAAGG - Intergenic
939276496 2:140004554-140004576 ACTAATATCCAGAATATGCAAGG + Intergenic
939364791 2:141217843-141217865 ACTGATGTCCAAAATCTTTAAGG + Intronic
939371275 2:141304143-141304165 ACTAATATCCAGAATATACAAGG - Intronic
939469101 2:142596995-142597017 ACTAATATCCAAAGTTTGCAAGG - Intergenic
939478150 2:142713112-142713134 ACTAATATCCAGAATCTACAAGG + Intergenic
939592995 2:144089074-144089096 ACTAATATCCAGAATATACAAGG + Intronic
939757135 2:146128651-146128673 TCTAATATCCAAAATCTACAAGG - Intergenic
939942554 2:148367589-148367611 GCTAATATCCAGAATGTACAAGG + Intronic
940125692 2:150321361-150321383 ACTGATTCCAAAAATGTGGAGGG + Intergenic
940365125 2:152839805-152839827 ACTAATATCCAGAATCTACAAGG - Intergenic
940442249 2:153730659-153730681 ACTGCTATCCAGAATCTACAGGG + Intergenic
940587704 2:155675092-155675114 ACTCATATCCAAAATCTACAAGG + Intergenic
940674461 2:156711796-156711818 TCTAATATCCAAAATTTACAGGG - Intergenic
941308685 2:163902484-163902506 ACTCATATCTAGAATATGCAAGG + Intergenic
941339828 2:164293287-164293309 ACTAATATCCAGAATCTACAAGG + Intergenic
941358386 2:164520618-164520640 ACTAATATCCAGAATCTACAAGG + Intronic
941431070 2:165414990-165415012 ACTAATATCCAGAATTTACAAGG - Intergenic
941467647 2:165848850-165848872 ACTAATATCCAGAATATGCAAGG - Intergenic
941520729 2:166538729-166538751 ACTAATATCCAGAATCTACAAGG - Intergenic
941522662 2:166566754-166566776 GTTAATATCCAAAATGTGTAAGG + Intergenic
941680163 2:168389400-168389422 GCTCATATCCAAAATATACAAGG + Intergenic
941973423 2:171377499-171377521 ACTAATATCCAGAATCTACAAGG + Intronic
942052305 2:172151452-172151474 ACTAATATCCAGAATCTACAAGG - Intergenic
942341607 2:174954555-174954577 ACTAATATCCAGAATCTACAAGG + Intronic
942478094 2:176350696-176350718 ACTAATATTCAGAATATGCAAGG - Intergenic
942539442 2:177000448-177000470 CCTTCTATCCATAATGTGCAAGG + Intergenic
942849654 2:180469170-180469192 ATTAATATCCAAAATATACAAGG + Intergenic
943090255 2:183365547-183365569 ACTAATATCCAAAATATAGAAGG - Intergenic
943250561 2:185516864-185516886 TCTAATATCCAAAATATACAAGG - Intergenic
943492059 2:188566895-188566917 TCTAATATCCAGAATTTGCAAGG + Intronic
943638314 2:190331108-190331130 ACTAATATCCAGAATCTACAAGG + Intronic
943714892 2:191140357-191140379 ACTAATATCCATAATCTGCAAGG + Intronic
943812233 2:192201841-192201863 ACTTATATCCAAGATGGGGATGG - Intergenic
943901691 2:193446931-193446953 ACTAATATCCAGAATCTACAAGG - Intergenic
943970900 2:194404839-194404861 GCTAATATCCAGAATCTGCAAGG - Intergenic
944091878 2:195920831-195920853 ACTAATATCCAGAATCTACAAGG + Intronic
944175529 2:196824876-196824898 AGTTATATCCAAAATATACAAGG + Intergenic
944261522 2:197683028-197683050 TCTAATATCCAAAATCTACAAGG - Intergenic
944346344 2:198670550-198670572 GCTAATATCCAAAATCTACAGGG - Intergenic
944378447 2:199076852-199076874 ACTAATATCCAGAATCTACAAGG + Intergenic
944524613 2:200605864-200605886 TCTAATATCCAGAATCTGCAAGG - Intronic
945031419 2:205667429-205667451 ACTAATATCCAGAATATACAAGG - Intergenic
945328008 2:208505645-208505667 TCTAATATCCAAAATATACAAGG - Intronic
945545223 2:211141755-211141777 ACTAATATCCAGAATCTTCAAGG - Intergenic
945722433 2:213434581-213434603 ACTGATATCCAGAATTTATAGGG + Intronic
945758321 2:213878533-213878555 AATGATATCCAGAATTTACAAGG - Intronic
946553565 2:220829800-220829822 GCTAATATCCAGAATGTACAAGG + Intergenic
946795801 2:223351383-223351405 ACTAATATCCAGAATCTACAAGG + Intergenic
946944772 2:224809456-224809478 GCTGATATCCAAACTCTACAAGG + Intronic
947439126 2:230102246-230102268 TCTAATATCCAGAATGTACAAGG - Intergenic
947460953 2:230305017-230305039 ACTAATATCCAGAATCTACAAGG + Intronic
947478599 2:230475416-230475438 TCTGATATCCAGAATCTACAAGG - Intronic
947737913 2:232467134-232467156 GCTAATATCCAAAATATACAAGG - Intergenic
947974719 2:234355723-234355745 ACAGATTTCCTGAATGTGCAGGG + Intergenic
948110744 2:235453651-235453673 GTTGATATCCAAAATCTGCAAGG - Intergenic
948754686 2:240151977-240151999 AGTGATATCCACAAGGTTCAAGG + Intergenic
1169316600 20:4596399-4596421 AATAACATCCAAAATATGCATGG - Intergenic
1169397512 20:5246172-5246194 ACTAATATCCAGAATCTACAAGG - Intergenic
1169579719 20:7006423-7006445 AATAATATCCAAAATATGTAAGG + Intergenic
1169586741 20:7094410-7094432 ACTAATATCCATAATTTACAAGG - Intergenic
1169855521 20:10097954-10097976 ACTAATATCCATAATCTACAAGG - Intergenic
1169983936 20:11421118-11421140 GCTAATATCCAAAATCTACAAGG - Intergenic
1170126887 20:12973515-12973537 ACTAATATCCAGAATCTACAAGG - Intergenic
1170248989 20:14258590-14258612 ACTAATATCCAGAATCTACAGGG - Intronic
1170456095 20:16534399-16534421 ACTCATATCCAGAATATACAAGG - Intronic
1170489050 20:16852655-16852677 ACTAATATCCAGAATCTACAAGG - Intergenic
1170518413 20:17156320-17156342 ACTGATATCCAAAAAATACAAGG - Intergenic
1170971435 20:21120590-21120612 ACTGCTCTCCAAAATGTGGATGG - Intergenic
1171721431 20:28567531-28567553 ACTAATACCCAGAATCTGCAAGG + Intergenic
1171862685 20:30415289-30415311 ACTAATACCCAGAATCTGCAAGG - Intergenic
1173482269 20:43411895-43411917 ACTAATATCCAGAATCTACAAGG + Intergenic
1173758678 20:45540531-45540553 TCTGATATCCAGAATCTACAAGG + Intronic
1173768667 20:45638194-45638216 GCTAATATCCAAAATATGTAAGG - Intergenic
1174736415 20:52970012-52970034 ACTAATATCCAGAATCTACAAGG + Intergenic
1174875151 20:54220022-54220044 ACTGATGTGCCAAATGTGAATGG + Intronic
1175343691 20:58253548-58253570 ACTAATATCCAGAATCTACAAGG + Intergenic
1175554911 20:59843936-59843958 ACTAATATCCAGAATATACAAGG + Intronic
1175617667 20:60415220-60415242 ACTAATATCCAGAATATACAAGG - Intergenic
1176525478 21:7863682-7863704 ACTAATATCCAGAATCTACAAGG - Intergenic
1176930796 21:14807540-14807562 GCTAATATCCAAAATATACAAGG + Intergenic
1177069161 21:16480890-16480912 ACTAATATCCAGAATCTACAAGG - Intergenic
1177070340 21:16497883-16497905 ACTAATATCCAGAATCTACATGG - Intergenic
1177136891 21:17314180-17314202 GCTAATATCCAAAATCTACAAGG + Intergenic
1177178703 21:17721976-17721998 ACTAATATCCAAAATTTACAAGG + Intergenic
1177198941 21:17932065-17932087 ACTAATATCCAGAATCTACAAGG + Intronic
1177283055 21:19009931-19009953 ATTGTTATCCAAAATATACAAGG + Intergenic
1177463831 21:21447656-21447678 TCTGATATCCATAATTTACAAGG + Intronic
1177490764 21:21823166-21823188 TCTAATATCCAGAATCTGCAAGG - Intergenic
1177538740 21:22463955-22463977 ACTCATATCCAGAATGTATAAGG - Intergenic
1177750069 21:25270301-25270323 ACTAATATCCAGAATCTACAAGG + Intergenic
1178352357 21:31881257-31881279 ACTCATATCCAAAATGCGCATGG - Intronic
1178659498 21:34493695-34493717 ACTAATATCCAGAATCTACAAGG - Intergenic
1179261421 21:39761524-39761546 TCTAATATCCAGAATCTGCAAGG + Intronic
1179777847 21:43678654-43678676 ACTAATATCCAGAATCTACAAGG - Intronic
1179946339 21:44680148-44680170 ACTAATATCCAGAATATGTAAGG + Intronic
1180040292 21:45275038-45275060 ACTAATATCCAGAATCTACAAGG + Intronic
1180294969 22:10926152-10926174 ACTAATACCCAGAATCTGCAAGG + Intergenic
1180644286 22:17325698-17325720 ACTGTTATTCAAAATATGCAAGG + Intergenic
1181121953 22:20675259-20675281 ACTAATATCCAGAATCTACATGG - Intergenic
1181717508 22:24743002-24743024 ACTGATATCCAGAATCTACAAGG + Intronic
1183008204 22:34921338-34921360 TCTAATATCCAGAATCTGCAAGG + Intergenic
1184625491 22:45724547-45724569 ACTAATATCCAGAATCTACAAGG - Intronic
949109403 3:240478-240500 ACTGACATCCAGAATCTACAAGG - Intronic
949189969 3:1240283-1240305 ACTGATATCGAGAATCTACAAGG + Intronic
949378369 3:3415878-3415900 ACTAATATCCAGAATCTACAAGG + Intergenic
949570502 3:5287676-5287698 ACTCATATCCAGAATCTACAAGG - Intergenic
949832729 3:8233216-8233238 TCTGAAATACAAAATGGGCATGG - Intergenic
949991937 3:9586577-9586599 ACTAATATCCAGAATCTACAAGG - Intergenic
950342119 3:12256842-12256864 ACTAATATCCAGAATCTACAAGG - Intergenic
950616381 3:14162879-14162901 ACTAATATCCAGAATATACAAGG + Intronic
950977996 3:17270364-17270386 TTTGATATCCAAAATGTATAAGG - Intronic
951285288 3:20804192-20804214 ACCAATATTCAAAATATGCAAGG - Intergenic
951326395 3:21307352-21307374 ACTAATATCCAGAATCTACACGG + Intergenic
951404603 3:22280153-22280175 ACTAATATCCAGAATCTACAAGG - Intronic
951433560 3:22636293-22636315 ACTAATATCCAGAATTTACAAGG - Intergenic
951508346 3:23474266-23474288 ACTAATATCCAGAATCTACAAGG - Intronic
951514540 3:23544319-23544341 ACTGATATCCAGAATCTACAAGG + Intronic
951675741 3:25239181-25239203 ACTAATATCCAGAATATACAAGG - Intronic
951812251 3:26713758-26713780 AATGATATACAAAATCTGCCAGG + Intergenic
951825954 3:26868741-26868763 ACTGATATCCAGAATTTACACGG - Intergenic
951868966 3:27339052-27339074 ACTAATATCCAAAATATACAAGG + Intronic
952078415 3:29727478-29727500 TCTAATATCCAGAATGTACAAGG + Intronic
952233773 3:31458178-31458200 ATTAATATCCAGAATATGCAAGG + Intergenic
952476041 3:33711636-33711658 ACTAATATCCAGAATCTACAGGG + Intronic
952511385 3:34060349-34060371 GCTAATATCCAGAATGTACAAGG + Intergenic
952519026 3:34136494-34136516 ACTAATATCCAGAATCTACAAGG + Intergenic
952572775 3:34737095-34737117 TGTGATATCCAAAATGTACAAGG + Intergenic
952677052 3:36045246-36045268 GCTAATATCCAGAATGTACAAGG - Intergenic
952695007 3:36254725-36254747 TCTAATATCCAAAATCTACAAGG + Intergenic
952714451 3:36465338-36465360 ACTAATATCCAGAATCTACAAGG - Intronic
952734155 3:36671921-36671943 ACTAATATCCAGAATCTACAAGG + Intergenic
952941371 3:38447031-38447053 ACTAATATCCAGAATATACAAGG + Intergenic
953185758 3:40636890-40636912 ACTAATATCCAGAATCTACAAGG + Intergenic
953220237 3:40963601-40963623 ACTAATATCCATAATATACAAGG - Intergenic
953280713 3:41553365-41553387 ACTAATATCCAAAATATAAAAGG + Intronic
953592805 3:44276081-44276103 ACTAATATCCAGAATATACAAGG - Intronic
953639904 3:44697182-44697204 ACTAATATCCAGAATCTACAAGG + Intergenic
953779712 3:45856644-45856666 TCTAATATCCAAAATCTACAAGG + Intronic
953806457 3:46073687-46073709 ACTAATATCCAGAATTTACAAGG + Intergenic
954479337 3:50783579-50783601 ACTAATATCCAGAATCTACAAGG - Intronic
954521796 3:51234369-51234391 ACTAATATCCAAAATGTATAAGG - Intronic
954528284 3:51293721-51293743 ACTAATATCCAAAATATACAAGG + Intronic
954946258 3:54427198-54427220 ACAGATAACCTACATGTGCAGGG - Intronic
954951014 3:54473645-54473667 ACTAATATCCAGAATCTACAAGG + Intronic
955117036 3:56016085-56016107 TCTAATATCCAGAATATGCAAGG - Intronic
955225306 3:57055559-57055581 ATTGAGAACCTAAATGTGCAAGG - Intronic
955257935 3:57353640-57353662 TCTAATATCCAAAATCTGTAAGG + Intronic
955355513 3:58228169-58228191 TCTGATATCCAGAATCTACAAGG + Intergenic
955561366 3:60194694-60194716 ACTAATATCCAGAATCTGCTAGG + Intronic
955704221 3:61711700-61711722 GCTGATATCCAGAATCTACAAGG + Intronic
955802196 3:62697974-62697996 ACTAATATCCAGAATCTACAAGG - Intronic
955862660 3:63348409-63348431 ACTGATATCCAGAATTTACAAGG - Intronic
955898981 3:63731880-63731902 ACTAATATCCAGAATCTACAAGG + Intergenic
956279141 3:67537948-67537970 GCTAATATCCAGAATCTGCAAGG - Intronic
956298452 3:67740549-67740571 ACTAATATCCAGAATATACAAGG - Intergenic
956303559 3:67798896-67798918 ACTAATATCCAGAATGTACAAGG - Intergenic
956318812 3:67971782-67971804 GCTAATATCCAAAATATGTAAGG + Intergenic
956341812 3:68233232-68233254 ACTAATATCCAAAATATACAAGG - Intronic
956571902 3:70705856-70705878 GCTGATATCTATAATGTGAAAGG + Intergenic
956809859 3:72854350-72854372 ACTAATATCCAGAATTTACAAGG - Intronic
956992306 3:74781110-74781132 ACTAATATCCAGAATCTACAAGG + Intergenic
957279954 3:78137598-78137620 ACTAATAGTCAATATGTGCAAGG - Intergenic
957289676 3:78263027-78263049 ACTAATATCCAAAATATACAAGG - Intergenic
957405505 3:79770633-79770655 ACTGATATCCATTATGTCCTTGG + Intergenic
957419017 3:79944496-79944518 ACTAATATCCAGAATCTACAAGG + Intergenic
957688464 3:83536371-83536393 ACTGATATCCAGAATTTGCAAGG + Intergenic
957691203 3:83572511-83572533 ACTAATATCCAGAATCTACAAGG - Intergenic
957763966 3:84596773-84596795 ACTAATATCCAGAATCTACAAGG + Intergenic
957920367 3:86739965-86739987 ATTTATATTCAAAATGTTCAAGG - Intergenic
957963246 3:87288392-87288414 ACTAATATCCAGAATATACAAGG + Intergenic
957963944 3:87297527-87297549 ACTGTTATCCAAAATATGTTTGG + Intergenic
958152519 3:89708887-89708909 ACTAATATCCAGAATTTACAGGG + Intergenic
958438761 3:94130317-94130339 TCTGATATCCACTTTGTGCAGGG - Intergenic
958509717 3:95032090-95032112 ACTAATATCCAGAATCTACATGG - Intergenic
958519004 3:95159593-95159615 GCTGATATCCAGAATCTACAAGG - Intergenic
958605192 3:96349804-96349826 ACTGATACTCAATATGTGCTCGG - Intergenic
958607968 3:96384585-96384607 ACTGATATCCAGAATTTATAAGG - Intergenic
958773031 3:98448738-98448760 GCTAATATCCAAAATCTACAAGG + Intergenic
958789795 3:98638548-98638570 ACTAATATCCAGAATCTACAAGG - Intergenic
958846897 3:99275803-99275825 ATTAATATCCAAAATATACAAGG - Intergenic
959006235 3:101023176-101023198 ACTAATATCCAAAATCTACACGG - Intergenic
959160521 3:102718792-102718814 ACTAATATCAAGAATATGCAAGG - Intergenic
959365499 3:105452951-105452973 TCTAATATCCAGAATCTGCAAGG - Intronic
959369834 3:105509602-105509624 GTTGATATCCAAAATATGTAAGG - Intronic
959492730 3:107010896-107010918 ACTAATATCCAGAATATACAAGG + Intergenic
959706642 3:109344143-109344165 ACTAATATCCAGAATATACAAGG - Intergenic
959846946 3:111043803-111043825 ACTGATATCCAGGATATACAAGG + Intergenic
959905460 3:111706251-111706273 ACTAATATCCAGAATATACAAGG - Intronic
960124067 3:113978772-113978794 AATGAAATCCAGAATGTCCAGGG - Intronic
960156720 3:114304130-114304152 ACTAATATCCAGAATCTACAAGG - Intronic
960233986 3:115260223-115260245 TCTGATATCCAGAATTTACAAGG + Intergenic
960243026 3:115367578-115367600 ACTAATATCCAAAATATATAAGG + Intergenic
960470399 3:118057640-118057662 TTTGATATCCAAAATGTGTCAGG + Intergenic
960500359 3:118430462-118430484 TCTGATATCCAGAATGTATAAGG - Intergenic
960500440 3:118431246-118431268 TCTGATATCCAGAATGTATAAGG - Intergenic
960517001 3:118613370-118613392 ACTAATATCCAGAATCTACAAGG + Intergenic
960549108 3:118953780-118953802 ACTAATATCCAGAATCTGCAAGG - Intronic
960712861 3:120548458-120548480 TCTAATATCCAAAATCTACAAGG - Intergenic
960772683 3:121212093-121212115 GCTAATATCCAAAATCTACAAGG - Intronic
960866928 3:122211350-122211372 CCTGATATCCAGAATCTACAAGG + Intronic
961089723 3:124100259-124100281 ACTGATATCCAGAATATACAAGG - Intronic
961350481 3:126298332-126298354 ACTAATATCCAGAATCTGCAAGG - Intergenic
961407897 3:126695341-126695363 ACTGATATCCAGAATCTGTAAGG - Intergenic
961911543 3:130322231-130322253 ATTAATATCCAAAATATGTAGGG + Intergenic
961955524 3:130798889-130798911 ACTAATATCCAGAATATACAAGG + Intergenic
962390712 3:134969986-134970008 ACTTATATCCAAAATATATAAGG - Intronic
962591435 3:136893519-136893541 ACTAATATCCAGAATCTACAAGG - Intronic
962650597 3:137485256-137485278 ACTAGTATCCAGAATGTACAAGG - Intergenic
962822537 3:139065758-139065780 ACTAATATCCAGAATATACAAGG - Intronic
963013463 3:140798093-140798115 ACTAATATCCAGAATCTACAAGG - Intergenic
963014105 3:140804091-140804113 ACTAATATCCAGAATCTACAAGG - Intergenic
963022084 3:140882054-140882076 ACTAATATCCAGAATCTACAAGG + Intergenic
963049985 3:141133185-141133207 ACTAATATCCAGAATCTACAAGG - Intronic
963383979 3:144567783-144567805 ACTAATATCCAGAATCTGCAAGG + Intergenic
963484335 3:145917759-145917781 ATTAATATCCAAAGTGTACAAGG + Intergenic
963523552 3:146387313-146387335 ACTGATAAGCAAAATGTTCTTGG + Intergenic
963559098 3:146838240-146838262 ACTAATATCCAGAATCTACAAGG + Intergenic
963617966 3:147567712-147567734 ACTAATATCCAGAATTTACAAGG + Intergenic
963680656 3:148371597-148371619 AGTGACATCCAACATGTGCATGG + Intergenic
963813718 3:149806513-149806535 ACTAATATCCAGAATATACAAGG - Intronic
963830380 3:150001386-150001408 ACTAATATCCAGAATATACAAGG + Intronic
963877203 3:150489883-150489905 ATTAATATCCAAAATATACAAGG + Intergenic
963927261 3:150964176-150964198 ACTAATATCCAGAATCTACAAGG + Intronic
963996166 3:151711504-151711526 ACTAATATCCAGAATATACAAGG + Intergenic
963996811 3:151719020-151719042 ATTAATATCCAAAATGTATAAGG - Intergenic
964008963 3:151866559-151866581 ACTAATATCCAGAATCTACAAGG - Intergenic
964062834 3:152545074-152545096 ACCGATATCCAGAATTTTCAAGG + Intergenic
964148256 3:153492466-153492488 ATTGATATCCAGAATATTCAAGG + Intronic
964183796 3:153918476-153918498 TCTGATATCCAGAATCTACAAGG + Intergenic
964183802 3:153918558-153918580 TCTGATATCCAGAATCTACAAGG + Intergenic
964298952 3:155266388-155266410 ACTAATATCCAGAATCTACAAGG + Intergenic
964302780 3:155308035-155308057 ACTAATATCCAGAATCTACAAGG - Intergenic
964328210 3:155571559-155571581 ACTAAAATACAAAATGAGCAGGG - Intronic
964332136 3:155615046-155615068 ACTAATATCCAGAATCTACAAGG + Intronic
964537767 3:157743468-157743490 ACTAATATCCAGAATCTACAAGG - Intergenic
964565306 3:158044240-158044262 ACTAATATCCAGAATCTACAAGG + Intergenic
964773167 3:160245886-160245908 ACTAATATCCAAAATCTACAAGG + Intronic
964831727 3:160891237-160891259 TCTAATATCCAAAATTTACAAGG + Intronic
964844828 3:161033954-161033976 GCTAATATCCAGAATCTGCAAGG + Intronic
964868029 3:161283100-161283122 ACTAATATCCAGAATCTACAAGG + Intergenic
965013806 3:163130520-163130542 ACTAATATCCAGAATCTACATGG + Intergenic
965075512 3:163969913-163969935 ACTGATATTCAGAATATACAAGG + Intergenic
965290182 3:166868662-166868684 ACTAATATCCAGAATCTACAAGG - Intergenic
965317164 3:167207227-167207249 TCTAATATCCAAAATATGTAAGG + Intergenic
965806489 3:172547492-172547514 ACTGAGAGTCAAAATGTGCAAGG - Intergenic
965839575 3:172888125-172888147 ACTAATATCTAAAATATACAAGG - Intergenic
966086574 3:176075408-176075430 ACTGATATCCAGAGTTTACAAGG + Intergenic
966122794 3:176541675-176541697 ACTAATATCCAGAATCTACAAGG + Intergenic
966157930 3:176937279-176937301 TCTGATATCCAGAATTTACAAGG - Intergenic
966158473 3:176944063-176944085 ACTAATATCCAAAATCTACAAGG + Intergenic
966534139 3:181012245-181012267 ACTAATATCCAGAATCTACAAGG - Intergenic
966623820 3:181995064-181995086 ACTAATATCCAGAATCTACAAGG + Intergenic
966628720 3:182048420-182048442 ACTAATATCCAGAATCTACAAGG - Intergenic
966632697 3:182096160-182096182 TCTAATATCCAGAATGTACAAGG - Intergenic
967442376 3:189524028-189524050 GCTAATATCCAGAATCTGCAAGG + Intergenic
968245873 3:197146906-197146928 ACTAATATCCAGAATCTACAAGG + Intronic
969165234 4:5303562-5303584 ACTAATATCCAGAATCTACAAGG - Intronic
969271160 4:6103834-6103856 ACTAATATCAAAAATGTAAAGGG - Intronic
969382283 4:6810691-6810713 ACTGATATCCAGAATATACAAGG + Intronic
969952188 4:10849021-10849043 TCTGATATCCAGAATTTACAAGG - Intergenic
969970545 4:11043147-11043169 ACTAACATCCAGAATCTGCAAGG - Intergenic
970184632 4:13437475-13437497 ACTAATATCCAGAATCTGTAAGG + Intronic
970286790 4:14526696-14526718 TCTAATATCCAAAATCTGCAAGG + Intergenic
970378920 4:15485848-15485870 ACTGATATCCAGAATATACTAGG - Intronic
970548142 4:17150463-17150485 GCTGATATTCAAAATGCACAAGG + Intergenic
970736898 4:19182034-19182056 GCTAATATCCAGAATCTGCAAGG + Intergenic
970843094 4:20499261-20499283 ACTAATATCCAGAATCTACAAGG - Intronic
971237978 4:24860707-24860729 ACTAATATCCAGAATCTACAAGG + Intronic
971408030 4:26340378-26340400 ACGGTGGTCCAAAATGTGCAAGG + Intronic
971429588 4:26551435-26551457 ACTAATATCCAGAATCTACAAGG - Intergenic
971450642 4:26798156-26798178 ACTAATATCCAGAATCTACAAGG + Intergenic
971471821 4:27034802-27034824 ACTAATATCCAGAATCTACAAGG - Intergenic
971550587 4:27950966-27950988 TCTAATATCCAGAATGTGTAAGG + Intergenic
971554570 4:27997310-27997332 ACTAATATCCAGAATCTACAAGG - Intergenic
971560295 4:28071213-28071235 ACTAATATCCAGAATTTACAAGG + Intergenic
971622711 4:28876077-28876099 ACTAATATCCAGAATCTACAAGG - Intergenic
971838501 4:31801094-31801116 TCTAATATCCAAAATCTACAAGG - Intergenic
971852440 4:31999931-31999953 CATGATTTCCAAAGTGTGCATGG - Intergenic
971940546 4:33209369-33209391 ACTAATATCCAGAATCTACAAGG + Intergenic
972214934 4:36886506-36886528 TCTGATATCCAGAATCTGTAAGG - Intergenic
972231829 4:37081742-37081764 TCTGATATCCAGAATCTACAAGG + Intergenic
972384861 4:38555256-38555278 ACTAATATCCAGAATCTACAAGG - Intergenic
972860832 4:43167824-43167846 ACTGATATCCAGAATCTACAAGG - Intergenic
972861332 4:43172510-43172532 TCTAATATCCAAAATCTACAAGG + Intergenic
972919516 4:43920873-43920895 TCTAATATCCAGAATCTGCAAGG + Intergenic
972927460 4:44028776-44028798 ACTAATATCCAGAATATACAAGG + Intergenic
972955822 4:44390015-44390037 ACTAATATCCAGAATCTACAAGG - Intronic
973554127 4:52065148-52065170 ACTAATATCCAGAATCTACAAGG - Intronic
973577661 4:52307140-52307162 ACTAATATCCAGAATCTACAAGG - Intergenic
973596372 4:52494668-52494690 ACTAATATCCAGAATATACAAGG + Intergenic
973792170 4:54388300-54388322 ACTAATATCCAGAATCTACAAGG - Intergenic
973853963 4:54992268-54992290 ACTAGTATCCAGAATGTACAAGG + Intergenic
973934969 4:55835734-55835756 ACTAATATCCAGAATCTACAAGG - Intergenic
973971917 4:56221617-56221639 ACTCATATTCAGAATCTGCAAGG + Intronic
974081977 4:57223486-57223508 ACTGATATCCAAAATCTACAAGG - Intergenic
974133361 4:57784310-57784332 ACTAACATCCAGAATGTACAAGG - Intergenic
974281353 4:59798299-59798321 ACTGATATCCAGAATCCACAAGG - Intergenic
974372692 4:61038067-61038089 ACTAATATCCAGAATCTACAAGG - Intergenic
974376180 4:61079490-61079512 ACTAATATCCAGAATCTGCAAGG + Intergenic
974656731 4:64833830-64833852 ACTAATATCCAGAATCTACAAGG + Intergenic
974712205 4:65612755-65612777 ACTAATATCCAGAATCTACAAGG - Intronic
974790212 4:66678924-66678946 ACTAATATCCAGAATCTACAAGG + Intergenic
974889052 4:67856744-67856766 ACTAATATCCAGAATATACAAGG + Intronic
975148911 4:70999901-70999923 GCTAATATCCAAAATCTACAAGG - Intronic
975239897 4:72044776-72044798 ACTAATATCCAGAATATACAAGG - Intronic
975243412 4:72089698-72089720 ACTAATATCCAGAATCTACAAGG - Intronic
975375394 4:73637935-73637957 ACTAATATCCAGAATGTACAAGG + Intergenic
975534987 4:75440654-75440676 ACTAATATCCAGAATCTACAAGG + Intergenic
975623742 4:76321023-76321045 ACTAATATCCAGAATCTACAAGG + Intronic
975773079 4:77750971-77750993 CATAATATCCAAAATGTCCAGGG + Intronic
975905417 4:79205490-79205512 ACTCATATCCAGAATCTACAAGG - Intergenic
975952791 4:79794278-79794300 TCTAATATCCAGAATTTGCAAGG + Intergenic
976086780 4:81415025-81415047 ACTAATATCCAGAATCTACAAGG + Intergenic
976157754 4:82166051-82166073 ACTAATATCCAGAATATACAAGG + Intergenic
976471990 4:85439687-85439709 ACTAATATCCAGAATATACAAGG - Intergenic
976666291 4:87596328-87596350 ACTAATATCCAGAATCTGCAAGG - Intergenic
976769124 4:88632358-88632380 CGTAATATCCAAAATGTTCATGG + Intronic
976791664 4:88885770-88885792 ACTAATATCCAGAATATACAAGG + Intronic
976869993 4:89780053-89780075 ACTAATATCCAGAATCTACAAGG + Intronic
977013378 4:91661238-91661260 ACTAATATCCAGAATATACAAGG - Intergenic
977180101 4:93863721-93863743 ACTAATATCCAGAATCTACAAGG + Intergenic
977444804 4:97117241-97117263 ACTAATATCCAGAATCTACAAGG - Intergenic
977552299 4:98455171-98455193 ACTAATATCCAGAATCTACAGGG + Intergenic
977623837 4:99168051-99168073 ACTAATATCCAGAATCTACATGG - Intergenic
977782968 4:101000078-101000100 ATTAATATCCAAAATATACAAGG - Intergenic
977793469 4:101134352-101134374 GCTAATATCCAGAATGTACAAGG + Intronic
977813934 4:101391543-101391565 ACTAATATCCAGAATCTACAAGG + Intergenic
977822930 4:101497487-101497509 ACTATTATCCAAAATATGCAAGG + Intronic
977829134 4:101569723-101569745 ACTAATATCCAGAATCTACAAGG + Intronic
977849497 4:101808621-101808643 ACTAATATCCAGAATGCACAAGG + Intronic
977930062 4:102741060-102741082 ACTAATATCCAGAATCTACAAGG + Intronic
978050795 4:104197373-104197395 ACTAATATCCAGAATCTACAAGG - Intergenic
978110433 4:104958003-104958025 ACTAATACCCAGAATGTGGAAGG - Intergenic
978163294 4:105575531-105575553 ACTAATATCCAGAATCTACAAGG - Intronic
978322326 4:107511420-107511442 AGTAATATCCAAAATGTACTTGG - Intergenic
978422778 4:108551652-108551674 ACTAATATCCAGAATATACAAGG + Intergenic
978549250 4:109907257-109907279 ACTAATATCCAGAATCTACAAGG + Intergenic
978677090 4:111331741-111331763 ACTAATATCCAGAATTTACAAGG + Intergenic
978917112 4:114140681-114140703 ACTGATATCCAGAATGTACAAGG - Intergenic
978929384 4:114292275-114292297 ACTAATATCCAGAATCTACAAGG + Intergenic
978946373 4:114503141-114503163 GCTGGTATCAAAAATGTGAAAGG - Intergenic
979068694 4:116172098-116172120 ACTAATATCTCAAATGTACAAGG - Intergenic
979190755 4:117854918-117854940 ACTAATATCTAGAATATGCAGGG + Intergenic
979357380 4:119720875-119720897 ACTAATATCCAGAATCTACAAGG + Intergenic
979426738 4:120576687-120576709 ACTGATATCCAAAATCTCCAAGG + Intergenic
979479753 4:121202690-121202712 ACTAATATCCAGAATCTACAAGG + Intronic
979501465 4:121445351-121445373 TCTAATATCCAAAATCTACAAGG + Intergenic
979527279 4:121730490-121730512 TCTAATATCCAGAATCTGCAAGG - Intergenic
979705747 4:123718317-123718339 GCTAATATCCAGAATCTGCAAGG + Intergenic
979712239 4:123793213-123793235 ACTAATATCCAGAATCTACAAGG - Intergenic
979743768 4:124183076-124183098 ACTTATATTCAAAATATGAAAGG + Intergenic
979774838 4:124577287-124577309 ACTAATATCCAGAATATACAGGG - Intergenic
979887486 4:126047364-126047386 ACTAATATCCAGAATCTACAAGG - Intergenic
979984897 4:127301645-127301667 ACTAATATCCAGAATCTACAAGG + Intergenic
980019577 4:127692469-127692491 ACTAATATCCAGAATCTACAAGG - Intronic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
980149872 4:129032601-129032623 TCTAATATCCACAATCTGCAAGG + Intronic
980276331 4:130655639-130655661 TCTAATATCCAGAATTTGCAAGG + Intergenic
980586447 4:134822654-134822676 ACTAATATCCAGAATCTGCAAGG - Intergenic
980994582 4:139768128-139768150 ACTAATATCCAAAATCTATAAGG - Intronic
981168909 4:141598265-141598287 ACTAATATCCATAATCTACAAGG + Intergenic
981257765 4:142683366-142683388 ACTGGTGTACAAAATGAGCATGG + Intronic
981263142 4:142747134-142747156 GCTAATATCCAAAATCTACAAGG + Intronic
981273544 4:142871638-142871660 ACTAATATCCAGAATCTACAAGG + Intergenic
981290237 4:143066512-143066534 ACTAATATCCAGAATTTACAAGG - Intergenic
981351520 4:143735182-143735204 ACTAACATCCAGAATGTACAAGG - Intergenic
981572162 4:146164040-146164062 ACTAATATCCAGAATCTACAAGG + Intergenic
981602320 4:146504222-146504244 AAAGATAACCAAAATGGGCAGGG + Intronic
981699433 4:147592827-147592849 ACTAATATCCAGAATCTACAAGG + Intergenic
981953163 4:150435674-150435696 ACTTATTTCCTAAATTTGCAAGG - Exonic
982020343 4:151196754-151196776 ACTAATATCCAGAATTTACAAGG + Intronic
982318214 4:154052733-154052755 ATTAACATCCAAAATATGCAAGG - Intergenic
982439453 4:155418247-155418269 ACTCATATCCAGAATATACAAGG - Intergenic
982451475 4:155557541-155557563 ACTGATATCCAGAAACTACAAGG + Intergenic
982636332 4:157901419-157901441 ACTGATATCCAGAATCTATAAGG - Intergenic
982804056 4:159741060-159741082 ACTAATATCCAGAATCTACAAGG - Intergenic
982884311 4:160759125-160759147 ACTTATATCCATAATTTACATGG + Intergenic
982896660 4:160938198-160938220 ACTAATATCCAGAATCTACAAGG + Intergenic
982950175 4:161684644-161684666 ACTAATATCCAGAATCTACAAGG - Intronic
982956377 4:161773456-161773478 ACTAATATACAGAATCTGCAAGG + Intronic
982961514 4:161844057-161844079 GCTAATATCCAGAATCTGCAAGG + Intronic
982976628 4:162070244-162070266 ATTAATATCCAAAATATCCAAGG - Intronic
983010765 4:162543906-162543928 ACTAATATCCAGAATCTACAAGG - Intergenic
983122052 4:163898302-163898324 ACTAATATCCAAAATCTGCAAGG + Intronic
983169183 4:164516486-164516508 TCTAATATCTAAAATCTGCAAGG - Intergenic
983174680 4:164574489-164574511 ACTAATATCCAAAATCTATAAGG + Intergenic
983233917 4:165157521-165157543 ACTAATATCCAGAATTTACAAGG + Intronic
983404701 4:167313243-167313265 ACTGATATCCAGAATCTACAAGG + Intergenic
983424403 4:167564140-167564162 ACTGAGGTCTAAAATGTCCATGG - Intergenic
983485646 4:168328903-168328925 TCTAATATCCAGAATGTACAAGG - Intergenic
983683430 4:170379517-170379539 ACTAATATTCAAAATCTTCAAGG + Intergenic
983729373 4:170974609-170974631 ACTAATATCCAAAAGCTACAAGG - Intergenic
983789556 4:171779417-171779439 AGTGATTTCCAAAATGTGATCGG + Intergenic
983895737 4:173079689-173079711 GCTGATATCCAGAATCTACAAGG - Intergenic
983909377 4:173219871-173219893 ACTAATATCCAGAATCTACAAGG - Intronic
984020712 4:174481774-174481796 ACTAATATCCAGAATATACAAGG + Intergenic
984089538 4:175354883-175354905 ACTAATATCCAGAATCTACAAGG + Intergenic
984290259 4:177785759-177785781 ACTAATATCCAGAATCTACAAGG + Intronic
984428055 4:179613350-179613372 ACTAATATCCAGAATCTGCAAGG + Intergenic
985332152 4:188849780-188849802 ACTAATATCCAAAATATGTAAGG - Intergenic
985389378 4:189479382-189479404 TCTAATATCCAAAATCTACAAGG + Intergenic
985991157 5:3562855-3562877 ACTAATATCCAGAATATGCAAGG - Intergenic
986300258 5:6472890-6472912 GATGAAATCCAAAATGTGAAAGG - Intronic
986378119 5:7153916-7153938 CCTAATATCCAGAATGTACAAGG - Intergenic
986467814 5:8044451-8044473 TCTAATATCCAGAATGTACAAGG + Intergenic
986539883 5:8833687-8833709 ACTAATATCCAGAATCTACAAGG + Intergenic
986617476 5:9633825-9633847 ACTAATATCCAGAATCTACAAGG - Intronic
986866480 5:11995215-11995237 GCTAATATCCAAAATCTACAAGG + Intergenic
986893212 5:12334140-12334162 ACTGATATCCAGAATCTTCAAGG - Intergenic
986917760 5:12644101-12644123 ACTAATATCCAGATTCTGCAAGG + Intergenic
987029953 5:13966739-13966761 ACTAATATCCAGAATCTACAAGG - Intergenic
987199582 5:15562373-15562395 ATTGATATCCAAAATATATAAGG + Intronic
987554719 5:19432149-19432171 ACTAATATCCAGAATCTACAAGG - Intergenic
987563953 5:19560774-19560796 ACTAATATCCAGAATCTACAAGG + Intronic
987712274 5:21516370-21516392 ACTAATATCCAGAATCTACATGG + Intergenic
987869724 5:23599828-23599850 TCCGATATCCAAAATTTACAAGG + Intergenic
987902268 5:24028225-24028247 ACTAATATCCAGAATCTTCAAGG + Intronic
987916490 5:24221325-24221347 ACTAATATCCAGAATTTACAAGG - Intergenic
988072850 5:26316580-26316602 ACTGATATCCAGAATCTATAAGG - Intergenic
988075903 5:26354057-26354079 ACTAATATCCAAAATATACAAGG - Intergenic
988076202 5:26358587-26358609 TCTGATATCCAGAATCTACAAGG - Intergenic
988084489 5:26457828-26457850 ACTAATATCCAGAATCTACAAGG - Intergenic
988302144 5:29444444-29444466 ACTAATATCCAGAATCTACATGG - Intergenic
988325721 5:29764591-29764613 ACTGATATCCAGAATCTATAAGG - Intergenic
988355384 5:30167165-30167187 ACTAATATCCAGAATCTACAAGG - Intergenic
988412520 5:30905355-30905377 ACTAATATCCAGAATCTACAAGG + Intergenic
988414152 5:30924682-30924704 AATAATATCCAAAATATGTAAGG + Intergenic
988462204 5:31449920-31449942 ACTAATATCCAGAATCTACAAGG + Intronic
988626203 5:32877533-32877555 ATTGATATCCAAAATACACAAGG - Intergenic
988639782 5:33028943-33028965 ACTAATATCCAGAATCTACAAGG + Intergenic
988645278 5:33088458-33088480 ACTGATATCCAAAATATACAAGG - Intergenic
988805374 5:34735194-34735216 ACTGATAGAAAAAATGGGCAGGG + Intronic
989032089 5:37129511-37129533 ACTAATATCCAGAATATACAAGG + Intronic
989159298 5:38374970-38374992 ACTAATATCCAGAATCTACAAGG - Intronic
989210987 5:38858980-38859002 ACTAATATCCAGAATATGCAAGG - Intronic
989231337 5:39090473-39090495 ACTAATATCCAGAATATGCTAGG + Intergenic
989347737 5:40448807-40448829 ACTAATATCCAGAATCTGCAAGG - Intergenic
989478294 5:41899621-41899643 ACTAGTATCCAGAATATGCAAGG - Intergenic
989498917 5:42142806-42142828 ACTATTATCCAAAATATGCCAGG + Intergenic
989561757 5:42860016-42860038 ACTAATATCCAGAATCTACAAGG - Intronic
989607604 5:43259664-43259686 ACTAATATCCAGAATTTACAGGG - Intronic
989610401 5:43285458-43285480 ACTAATATCCAGAATATACAGGG - Intergenic
989645675 5:43629856-43629878 ACTAATATCCAGAATCTACAAGG - Intronic
989693960 5:44177526-44177548 ACTAATATCCAGAATCTACATGG - Intergenic
989721311 5:44531798-44531820 ACTAATATCCAGAATCTACAAGG - Intergenic
990270990 5:54138782-54138804 ACTAATATCCAGAATCTACAAGG + Intronic
990689256 5:58344880-58344902 ACTAATATCCAGAATCTACAAGG + Intergenic
990737910 5:58883848-58883870 ACTAATATCCAAAATATACAAGG - Intergenic
990843520 5:60110283-60110305 ACTAATATCCAGAATATACAAGG + Intronic
990891330 5:60653480-60653502 ACTAATATCCACAATGTACGAGG - Intronic
990894584 5:60684844-60684866 ACTAATATCCAGAATATACAAGG + Intronic
990918277 5:60934453-60934475 ACTAATATCCAGAATATTCAAGG - Intronic
991015800 5:61931069-61931091 ACTAATATCCAGAATCTACAAGG - Intergenic
991132942 5:63146297-63146319 ACTGATAAGCAAAATTTGCAAGG + Intergenic
991207282 5:64064273-64064295 ATTAATATCTAAAATATGCAAGG + Intergenic
991287918 5:65000214-65000236 ACTGATATCCAGAATATAAAAGG - Intronic
991325065 5:65422068-65422090 ACTAATATCCAGAATCTACAAGG + Intronic
991543574 5:67756915-67756937 ACTAATATCCAGAATCTACAAGG + Intergenic
991652556 5:68870544-68870566 ACTAATATCCAGAATCTACAAGG + Intergenic
991762631 5:69935521-69935543 ACTAATATCCAGAATCTACATGG + Intergenic
991784695 5:70182605-70182627 ACTAATATCCAGAATCTACATGG - Intergenic
991841859 5:70810561-70810583 ACTAATATCCAGAATCTACATGG + Intergenic
991877141 5:71182985-71183007 ACTAATATCCAGAATCTACATGG - Intergenic
991948830 5:71928045-71928067 ACTAATATCCAGAATCTACAAGG + Intergenic
992026761 5:72677560-72677582 GCTAATATCCAGAATATGCAAGG - Intergenic
992121047 5:73592788-73592810 ACTAATATCCAAAATATGCAAGG - Intergenic
992899089 5:81275336-81275358 ACTAATATCCAAAATCTACAAGG + Intergenic
992967118 5:82013882-82013904 ACTAATATCCAGAATCTACAAGG - Intronic
993081043 5:83301453-83301475 TCTGATATCCAGAATCTACAAGG - Intronic
993207929 5:84908859-84908881 ACTAATATCCAGAATCTACAAGG - Intergenic
993249321 5:85497166-85497188 ACTTATATCCAGAATCTGCTAGG - Intergenic
993381025 5:87207927-87207949 ACTAATATCCAGAATCTACAAGG - Intergenic
993403164 5:87477811-87477833 GCTAATATCCAGAATCTGCAAGG + Intergenic
993540123 5:89138858-89138880 ACTAATATCCCAAATATACAAGG - Intergenic
993562188 5:89423857-89423879 ACTGACATCCAGAATCTACAAGG + Intergenic
993577462 5:89620195-89620217 GCTAATATCCAAAATCTACAAGG - Intergenic
993743698 5:91569780-91569802 ACTAATATCCAGAATCTACAAGG + Intergenic
994220484 5:97189360-97189382 ACTAATATCCAGAATCTACAAGG - Intergenic
994271056 5:97777507-97777529 TCTAATATCCAGAATCTGCAAGG + Intergenic
994404247 5:99323981-99324003 TCTAATATCCAGAATCTGCAAGG + Intergenic
994480462 5:100327815-100327837 ACTAATATCCAGAATCTACAAGG - Intergenic
994488649 5:100412012-100412034 ACTAATATCCAGAATGTGCAAGG - Intergenic
994595317 5:101825330-101825352 ACTAATATCCAGAATCTCCAAGG - Intergenic
994606673 5:101976064-101976086 ACTAATATCCAGAATCTACAAGG + Intergenic
994641517 5:102415818-102415840 ACTAATATCCAGAATATACAAGG + Intronic
994695841 5:103072674-103072696 TCTAATATCCAAAATTTACAAGG - Intergenic
994858882 5:105162220-105162242 GCTAATATCCAGAATCTGCAAGG + Intergenic
994872199 5:105366421-105366443 ACTAATATCCAGAATATACAAGG + Intergenic
994887738 5:105586594-105586616 ACTAATATCCAGAATCTACAAGG + Intergenic
994953761 5:106499676-106499698 ACTAATATCCAAAATCTACAAGG - Intergenic
995001753 5:107140243-107140265 ACTGGTATCCAGAATCTACATGG - Intergenic
995144816 5:108774771-108774793 TCTAATATCCAAAATTTTCAAGG - Intronic
995351252 5:111178178-111178200 ACTAATATCCAGAATCTACAAGG - Intergenic
995357596 5:111257263-111257285 TCTAATATCCACAATGTACAAGG + Intronic
995375295 5:111467462-111467484 ACTAATATCCAGAATCTACAAGG + Intronic
995416478 5:111918993-111919015 ACTAATATCCAGAATCTACAGGG + Intronic
995431681 5:112086313-112086335 ACTAATATCCAGAATCTACAAGG - Intergenic
995450754 5:112297511-112297533 ACTAATATCCAGAATCTACAAGG - Intronic
995587978 5:113669138-113669160 ACTAATATCCAGAATCTACAAGG + Intergenic
995617504 5:113982064-113982086 ACTAATATCCAGAATATACAAGG - Intergenic
995839967 5:116434744-116434766 ATTAATATCCAAAATATACAAGG - Intergenic
995868875 5:116723790-116723812 TCTTATAGCCAAAATGTCCAGGG - Intergenic
995999158 5:118337653-118337675 ACTAATATCCAGAATTTACAAGG + Intergenic
996110561 5:119561622-119561644 ACTAATATCCAGAATCTACATGG + Intronic
996128672 5:119754592-119754614 ACTAATATCCAGAATCTACAAGG + Intergenic
996137083 5:119856269-119856291 ACTAATATCCAGAATCTACAAGG + Intergenic
996140938 5:119908154-119908176 ACGAATATCCAAAATCTACAAGG - Intergenic
996239312 5:121175154-121175176 ACTGATATCCAGCATTTACAAGG - Intergenic
996426162 5:123315403-123315425 GCTGATATCCAGAATCTACAAGG - Intergenic
996489378 5:124074950-124074972 ACTAATATCCAGAATATACAAGG - Intergenic
996561697 5:124836878-124836900 ACTAATATCCAGAATCTACAAGG + Intergenic
996639634 5:125736722-125736744 ACTAATATCCAGAATCTACAGGG + Intergenic
996694582 5:126379786-126379808 ACTGATATCCAGAATGTACAAGG - Intronic
996751141 5:126890064-126890086 AAAGATATCCAAAAAGTCCAGGG - Intronic
996878610 5:128267699-128267721 TCTAATATCCAGAATCTGCAAGG - Intronic
996882977 5:128322163-128322185 GCTAATATCCAGAATCTGCAAGG - Intronic
997218829 5:132140043-132140065 ACTAATATCCAGAATCTACAAGG + Intergenic
997391160 5:133517765-133517787 ACTCAAGTCCAAAATCTGCAGGG + Intronic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
997576731 5:134984383-134984405 AATAATATCCAAAATCTACAAGG + Intronic
997775808 5:136603263-136603285 ACTAATATCCAGAATCTACAAGG - Intergenic
997806646 5:136924520-136924542 ACTGATATGCAAGATGGGGAGGG + Intergenic
997876565 5:137553604-137553626 AGTGATATCCAGAATCTACAAGG - Intronic
998702997 5:144726181-144726203 ACTAATATCCAGAATCTACAAGG - Intergenic
998816456 5:146018991-146019013 ACTAATATCCAGAATCTACAAGG - Intronic
999066470 5:148692187-148692209 ACTAATATCCTGAATCTGCAAGG + Intergenic
999413586 5:151374938-151374960 ACTGATATCCAGAATTTACAAGG - Intergenic
999575340 5:152970496-152970518 ACTAATATCCAGAATCTACAAGG + Intergenic
999593438 5:153174436-153174458 ACTAATATTCAAAATGTATAAGG - Intergenic
999675633 5:153999119-153999141 ACTAATATCCAGAATATACAAGG + Intronic
999724819 5:154427936-154427958 ACTAATATCCAGAATTTTCAAGG + Intergenic
999741304 5:154555458-154555480 ACTAATATCCAGAATCTACAAGG + Intergenic
1000024906 5:157350005-157350027 ACTAATACCCAAAATCTACAAGG - Intronic
1000236292 5:159364275-159364297 ACTAATATCCAGAATTTACAAGG - Intergenic
1000263030 5:159607808-159607830 ACTAATATCCAGAATGTATAAGG + Intergenic
1000453370 5:161418750-161418772 ACTAATATCCAGAATCTACAAGG + Intronic
1000460071 5:161504829-161504851 ACTAATTTCTAAAATGTTCATGG - Intronic
1000723081 5:164732834-164732856 ACTAATATCCAGAATTTGCAAGG + Intergenic
1000773959 5:165393683-165393705 ACTAATATCCAGAATATTCAAGG + Intergenic
1000859933 5:166445407-166445429 GCTAATATCCAAAATCTACAAGG - Intergenic
1000861720 5:166463766-166463788 ACTAATATCCAGAATCTACAAGG - Intergenic
1001165252 5:169359536-169359558 ACTAATATCCACAATATACAAGG + Intergenic
1001364929 5:171127476-171127498 ACTTATATCCAGAATATGCAAGG + Intronic
1001447888 5:171800332-171800354 ACTTACATCCAGAATGTACAAGG + Intergenic
1001715621 5:173813197-173813219 GCTGATATCCAGAATCTACAAGG + Intergenic
1001750218 5:174123827-174123849 ACTGATATCCAGAATCTACAAGG - Intronic
1001839235 5:174859721-174859743 TCTGATATCCAGAATTTACAAGG - Intergenic
1002269341 5:178059615-178059637 AATGTTAACCAAAATATGCATGG + Intergenic
1002757331 6:174152-174174 ACTAATATCCAGAATGTACAAGG + Intergenic
1002975769 6:2074388-2074410 ACTGATATCCAAAATGTGCAGGG - Intronic
1003465367 6:6375350-6375372 ACTAATATCCAGAATCTACAAGG + Intergenic
1003675267 6:8198296-8198318 ACTAGTATCCAAAATCTGCAAGG - Intergenic
1003703459 6:8496600-8496622 TCTAATATCCAAAATCTACAAGG - Intergenic
1003788021 6:9509502-9509524 ACTGTTATAAAAAATGAGCAAGG + Intergenic
1003851760 6:10230915-10230937 ACTAATATCCAGAATCTACAAGG + Intergenic
1004091841 6:12511284-12511306 ACTAATATCCAAAATATAAAAGG + Intergenic
1004096971 6:12565874-12565896 ACTAATATCCAGAATCTACAAGG + Intergenic
1004625415 6:17371600-17371622 ACTAATATCCAGAATCTACAAGG - Intergenic
1004760579 6:18661637-18661659 TCTTATATCCAGAATTTGCAAGG + Intergenic
1004766322 6:18731802-18731824 TCTTATATCCAAAATCTGTAAGG + Intergenic
1005126446 6:22451500-22451522 ACAGATATCCAAACTATACAAGG + Intergenic
1005260449 6:24053207-24053229 AATGAAAACCAAAAGGTGCAGGG - Intergenic
1005435498 6:25806789-25806811 ACTAATATCCACAATCTACAAGG + Intronic
1005880272 6:30052508-30052530 ACTAATATCCAGAGTGTACAAGG - Intergenic
1005919533 6:30387792-30387814 ACTAATATCCAGAATCTACAAGG + Intergenic
1005920769 6:30398605-30398627 ACTAATATCCAGAATATGTAAGG - Intergenic
1006061765 6:31426089-31426111 ACTGATGTCCAGAATCTACAAGG - Intergenic
1006250700 6:32781238-32781260 ACAAATATCCAAACTGTGGATGG - Intergenic
1006763936 6:36488205-36488227 ACTGATATCCAAAAATCCCATGG - Exonic
1006864466 6:37197964-37197986 ACTAATATCCAGAATCTACAAGG + Intergenic
1007131516 6:39478979-39479001 AGTAATATCCAGAATGTACAAGG - Intronic
1007280931 6:40711926-40711948 CCTGATATCCTAAATGGGCAGGG - Intergenic
1007534851 6:42577239-42577261 ACTGATATCCATAATGCAGAAGG + Intronic
1007815169 6:44517515-44517537 ACTAATATCCAGAATATGTAAGG - Intergenic
1007837712 6:44687235-44687257 ACTAATATCCAAAATCTACAAGG - Intergenic
1007872455 6:45055936-45055958 ACTAATATCCAGAATCTACAAGG + Intronic
1007891992 6:45303382-45303404 ACTAATATCCAGAATCTACAAGG + Intronic
1008095948 6:47339505-47339527 ACTAATATCCAGAATCTACAAGG + Intergenic
1008264250 6:49404563-49404585 ACTAATATCCAGAATCTACAGGG - Intergenic
1008289899 6:49702679-49702701 ACTAATATCCAGAATCTACAAGG - Intronic
1008431602 6:51424412-51424434 ACTAATATCCAGAATCTACAAGG + Intergenic
1008438664 6:51507034-51507056 ACTAATATCCAGAATCTGTAAGG + Intergenic
1008479483 6:51970329-51970351 ACTAATATCCAGTATCTGCAAGG - Intronic
1008774625 6:55022671-55022693 ATTAATATCCAAAATATACAAGG + Intergenic
1008890172 6:56479031-56479053 ACTAATATCCAGAATCTGCAAGG + Intronic
1009005382 6:57780017-57780039 ACTAATATCCAGAATCTACATGG - Intergenic
1009278292 6:61714156-61714178 ACTAATATCCAGAATCTACAAGG + Intronic
1009295693 6:61943762-61943784 ACTAATATCCAAACTATGCAAGG + Intronic
1009336747 6:62500113-62500135 AATGGTATCAAAAATGTGCTTGG - Intergenic
1009409907 6:63354256-63354278 ACTGATATCCAAAATACATAAGG + Intergenic
1009659810 6:66596337-66596359 ACTAATATCCAGAATCTACAAGG - Intergenic
1009955717 6:70450137-70450159 ACTAATATCCAAAATACACAAGG - Intronic
1010102587 6:72126533-72126555 ACTAATATCCTAAATCTACAAGG + Intronic
1010291632 6:74144325-74144347 TCTAATATCCAAAATCTACAAGG - Intergenic
1010610396 6:77947546-77947568 ACTACTATCCAAAATCTACAAGG - Intergenic
1010611647 6:77961058-77961080 TCTAATACCCAAAATATGCAAGG - Intergenic
1010620420 6:78067085-78067107 ACTTATATCTAAAATATACAAGG - Intergenic
1010638910 6:78297473-78297495 ACTAATATCCAAAATTTACAAGG + Intergenic
1010675199 6:78735391-78735413 ACTAATATCCACAATATCCAAGG - Intergenic
1010903883 6:81461538-81461560 ACTAATATCCAGAATCTACAAGG - Intergenic
1011006412 6:82650593-82650615 ACTAATATCCAGAATCTACAAGG + Intergenic
1011103188 6:83747378-83747400 ACTAATATCCAGAATCTGCAAGG + Intergenic
1011116780 6:83901903-83901925 ACTGATATCCAGAATATATAAGG - Intronic
1011141588 6:84163966-84163988 ACTAATATCCAGAATCTACAAGG + Intronic
1011156176 6:84335660-84335682 ACTAATATCCAGAATTTACAAGG - Intergenic
1011160603 6:84385808-84385830 ACTAATATCCAGAATCTACAAGG + Intergenic
1011249743 6:85358661-85358683 AATGATATCTAGAATATGCAGGG + Intergenic
1011373052 6:86660493-86660515 ACTAATATCCAGAATCTACAAGG - Intergenic
1011584977 6:88914886-88914908 ACTAATATCCAGAATCTACAAGG + Intronic
1011589530 6:88958482-88958504 ACTAATATCCAGAATCTACAAGG + Intronic
1011731688 6:90271310-90271332 ACTAATATCCAGAATCTACAAGG + Intronic
1011998114 6:93619038-93619060 GCTAATCTCCAAAATCTGCAAGG + Intergenic
1012117037 6:95313936-95313958 ACTAATATCCAGAATTTACAGGG + Intergenic
1012128140 6:95456008-95456030 ACTAATATCCAGAATCTACAAGG + Intergenic
1012148537 6:95717428-95717450 TCTGATATTAAAAATGAGCAAGG - Intergenic
1012202913 6:96428033-96428055 ATTAATATCCAAAATCTACAAGG - Intergenic
1012357101 6:98328296-98328318 ACTAATATCCAGAATCTACAAGG - Intergenic
1012393883 6:98773339-98773361 AATGATATCCAGAAAGTACATGG + Intergenic
1012487157 6:99735114-99735136 GCTAATATCCAGAATCTGCAAGG - Intergenic
1012808820 6:103931298-103931320 ACTAAGATCCAAAATTTACAAGG + Intergenic
1012874928 6:104714902-104714924 ACTGATATCAGAGAAGTGCAGGG - Intergenic
1012891957 6:104907051-104907073 AATGATATCCAAAGTAAGCAGGG - Intergenic
1013047400 6:106500544-106500566 ATTAATATCCAAAATATACAAGG - Intergenic
1013111035 6:107065407-107065429 TCTGATATCCACTTTGTGCAGGG + Exonic
1013256487 6:108391508-108391530 ACTGATATCCAGAATCTACAAGG - Intronic
1013259640 6:108428829-108428851 ACTAATATCCAGAATATACAAGG - Intronic
1013450227 6:110273481-110273503 ACTGAAATCCAGAATCTACAAGG + Intronic
1013453867 6:110311927-110311949 ACTAATATCCAGAATATACAAGG - Intronic
1013496006 6:110698270-110698292 ACTAATATCCAGAATCTACAAGG + Intronic
1013686064 6:112584495-112584517 ACTAATATCCAAAATCTACAAGG - Intergenic
1013728025 6:113124922-113124944 ACTAATATGCAACATGTGAATGG + Intergenic
1013901427 6:115161533-115161555 GCTAATATCCAGAATCTGCAAGG - Intergenic
1013930852 6:115530867-115530889 ACTAATATCCAGAATCTACAAGG - Intergenic
1013946034 6:115723434-115723456 ACTGATATCAAGAATCTACAAGG - Intergenic
1014085267 6:117335103-117335125 GCTAATATCCAGAATGTACAAGG + Intronic
1014328020 6:120024098-120024120 TCTAATATCCAGAATGTACAAGG + Intergenic
1014376601 6:120683134-120683156 ACTAATATCCAGAATCTACAAGG + Intergenic
1014383909 6:120778774-120778796 ACTGAAATGCAAGAGGTGCATGG - Intergenic
1014626781 6:123735966-123735988 ACTGATGTCCAGAATTTTCAAGG + Intergenic
1014791649 6:125679129-125679151 TTTGATATACAAAAAGTGCATGG - Intergenic
1014870305 6:126586634-126586656 ACTAATATCCATAATCTACATGG - Intergenic
1015206006 6:130639565-130639587 GCTAATATCCAGAATCTGCAAGG + Intergenic
1015281444 6:131439078-131439100 ACTAATATCCATAATTTGTAAGG + Intergenic
1015287216 6:131500026-131500048 GCTAATATCCAAAATGTATAAGG - Intergenic
1015387432 6:132640413-132640435 ACTAATATCCAGAATCTACAAGG + Intergenic
1015803029 6:137079952-137079974 ACTAATATCCAGAATCTACAAGG - Intergenic
1015807724 6:137128419-137128441 ACTAATATCCAAAATCTACAAGG - Intergenic
1016202857 6:141434040-141434062 TCTAATATCCAGAATTTGCAAGG + Intergenic
1016351325 6:143172063-143172085 ACCAATATCCAGAATGTACAAGG - Intronic
1016497982 6:144685740-144685762 ATTGATATCCAGAATCTACAAGG - Intronic
1016564667 6:145439695-145439717 TCTAATATCCAAAATCTTCAAGG - Intergenic
1016730828 6:147425813-147425835 ACTAATATCCAGAATCTACAAGG - Intergenic
1016807364 6:148225181-148225203 ACTGGTATCTGAAGTGTGCAGGG - Intergenic
1016822172 6:148357063-148357085 ACTAATATCCAGAATCTACAAGG - Intronic
1016934317 6:149437629-149437651 ACTAATATCCAGAATCTACAAGG - Intergenic
1016948355 6:149555580-149555602 ACTGATATCCAGAATCTGCAAGG + Intergenic
1017555919 6:155568185-155568207 ACTAATATCCAGAATGTACAAGG - Intergenic
1017593368 6:156001088-156001110 GTTGATATCCAAAATATGTAAGG - Intergenic
1017638782 6:156470011-156470033 GCTAATATCCAAAATATACAAGG + Intergenic
1017944421 6:159082190-159082212 ACTAATATCCAGAATCTACAAGG + Intergenic
1017944803 6:159087025-159087047 ACTAATATCCAGAATATACAAGG + Intergenic
1017966257 6:159269689-159269711 ACTGAAGTCCAAAATCTGCAGGG + Intronic
1018168329 6:161122108-161122130 ACTAATATCCAGAATCTACAAGG - Intergenic
1018294145 6:162327960-162327982 ACGGAGATCCAAGATGGGCATGG + Intronic
1018343418 6:162876588-162876610 ACTAATATCCAGAATCTACAAGG - Intronic
1018448656 6:163883762-163883784 ACTAATATCCAAAATATACAAGG + Intergenic
1018510842 6:164522650-164522672 TCTAATATCCAGAATCTGCAAGG - Intergenic
1018597179 6:165493933-165493955 ACTAATATCCAGAATCTACAGGG + Intronic
1018636894 6:165870211-165870233 ACTAATATCCAGAATATGTAAGG + Intronic
1018781340 6:167068949-167068971 ACTAATATCCAAAATCTACAAGG - Intergenic
1019009944 6:168836511-168836533 ACTAATATCCAGAATATACAAGG - Intergenic
1019098326 6:169606216-169606238 ACTAACATCCAAAATTTACAAGG + Intronic
1019113049 6:169733164-169733186 TCTAATATCCATAATTTGCAAGG - Intergenic
1019264447 7:105536-105558 ACTCATATCCAGAATATGTAAGG + Intergenic
1019847324 7:3518446-3518468 ACTAATATCCAGAATGTACTAGG + Intronic
1020449881 7:8308855-8308877 ACTAATATCCAGAATCTACAAGG - Intergenic
1020662678 7:11000740-11000762 ACTGATATCCAAAATATACAAGG - Intronic
1020775491 7:12449507-12449529 ACTGATATTCAGAATATACAAGG + Intergenic
1020826049 7:13030002-13030024 ACTAATATCCAGAATATACAAGG + Intergenic
1020929012 7:14369799-14369821 GCTGATATCCAGAATCTACAAGG - Intronic
1020985005 7:15122169-15122191 TCTAATATCCAAAATCTCCAAGG + Intergenic
1021204224 7:17760158-17760180 ACTAATATCCAGAATCTACAAGG + Intergenic
1021519135 7:21521350-21521372 ATTCATATCCAAAATGTATAAGG + Intergenic
1021858602 7:24882955-24882977 ACTAATATCCAGAATATACAAGG - Intronic
1022228360 7:28387456-28387478 TCTGATATCCAACATTTACAAGG - Intronic
1022240582 7:28508467-28508489 ACAGAAATTCAAAATGTGAAAGG + Intronic
1022410136 7:30133718-30133740 ACTAATATCCAGAATCTACAAGG + Intergenic
1022758409 7:33319820-33319842 ACTAATATCCAGAATTTACAAGG + Intronic
1022798331 7:33750852-33750874 ACTACTATCCAGAATGTGTAAGG - Intergenic
1022890744 7:34695565-34695587 ACTAATATCCAAAATATACAAGG + Intronic
1023053245 7:36271489-36271511 GCTAATATCCAAAATCTACAAGG - Intronic
1023509817 7:40939759-40939781 ACTAATATCCAGAATCTACAAGG - Intergenic
1023550456 7:41364817-41364839 TCTAATATCCAGAATCTGCAAGG + Intergenic
1023720324 7:43086705-43086727 ACTAATATCCATAATCTACAAGG + Intergenic
1023971630 7:44995732-44995754 ACTAATATCCAGAATATACAAGG + Intergenic
1024132271 7:46365667-46365689 ACTTATATTCAAAATATACAAGG - Intergenic
1024160216 7:46666657-46666679 ACTAATATCCAGAATCTACAAGG - Intergenic
1024236052 7:47399935-47399957 GCTAATATCCAAAATCTTCAAGG + Intronic
1024327581 7:48122445-48122467 ACTGATATCCAGAATCGTCAAGG - Intergenic
1024451949 7:49557440-49557462 ACTAATATCCAAAATCTACAAGG + Intergenic
1024840345 7:53578357-53578379 ACTAATATCCAGAATCTACAAGG + Intergenic
1024875787 7:54021442-54021464 ACTAATATCCAGAATCTACAAGG - Intergenic
1024910324 7:54440250-54440272 ACTCATATCTAAAATGTATAAGG - Intergenic
1025070971 7:55898686-55898708 ACTAATATCCAAAATATATAAGG + Intronic
1025611803 7:63081109-63081131 ACAGAAATCCAAAACGTTCAGGG + Intergenic
1025726530 7:64067013-64067035 GCTAATATCCAGAATCTGCAAGG + Intronic
1025857456 7:65294847-65294869 ACTAATATCCAGAATCTACAAGG - Intergenic
1026542594 7:71293570-71293592 ATTAATATCCAGAATATGCAAGG - Intronic
1026615737 7:71902032-71902054 CCTGATATCCAGAATCTACAGGG + Intronic
1027449364 7:78312488-78312510 ACTAATATCCAGAATCTACAAGG + Intronic
1027981046 7:85222914-85222936 ACTAATATCCAGAATCTGCAAGG + Intergenic
1028049359 7:86162629-86162651 TCTAATATCCAAAATTTACAAGG + Intergenic
1028059430 7:86292553-86292575 GTTAATATCCAAAATATGCAAGG - Intergenic
1028140255 7:87265609-87265631 GCTAATATCCAGAATCTGCAAGG + Intergenic
1028144782 7:87309666-87309688 GCTAATATCCAGAATCTGCAAGG + Intergenic
1028224045 7:88229068-88229090 ACTAATATCCAGAATATACAAGG + Intergenic
1028347683 7:89803103-89803125 ACTAATATCCAGAATCTACAAGG - Intergenic
1028490176 7:91402424-91402446 ACTAATATCCAGAATCTACAAGG - Intergenic
1028496885 7:91471539-91471561 ACTAATATCCATAATCTGCAAGG - Intergenic
1028519448 7:91713860-91713882 ACTAATACCCAAAATATACAAGG + Intronic
1028524289 7:91766194-91766216 AATGATATCCAGAACATGCAAGG + Intronic
1028564269 7:92210794-92210816 ACTAATATCCAAAATTTACAAGG + Intronic
1028608962 7:92687005-92687027 ACTAATATCCAGAATCTACAAGG - Intronic
1028627471 7:92893610-92893632 GCTAATATCCAAAATCTACAAGG - Intergenic
1028644628 7:93081642-93081664 TCTAATATCCAGAATGTACAAGG + Intergenic
1028644908 7:93085095-93085117 ACTAATATCCAGAATTTACAAGG + Intergenic
1028678088 7:93491518-93491540 TCTAATATCCAAAATTTACAAGG + Intronic
1028792492 7:94868412-94868434 ACTTATATCCAGAATCTACAAGG - Intergenic
1028945138 7:96571083-96571105 GCTAATATCCAAAATCTACAAGG - Intronic
1028967073 7:96814162-96814184 TCTAATATCCAGAATGTACAAGG + Intergenic
1028996179 7:97102690-97102712 ACTCATATCCAGAATCTACAAGG + Intergenic
1030604677 7:111627086-111627108 ACTAATATCCAGAATATACAAGG - Intergenic
1030788311 7:113690732-113690754 ACTAATATCCAGAATCTACAAGG + Intergenic
1030790725 7:113724843-113724865 ACTAATAAGCAAAATGTACAAGG + Intergenic
1030868169 7:114725069-114725091 ACTAATATCCAAAATATATAAGG - Intergenic
1030897298 7:115076612-115076634 GCTAATATCCAAAATCTACAAGG - Intergenic
1031090052 7:117343588-117343610 ACTAATATCCAGAATCTACAAGG - Intergenic
1031104107 7:117517930-117517952 GCTAATATCCAAAATCTACAAGG - Intronic
1031209303 7:118802093-118802115 ACTAATATCCAGAATCTACAAGG - Intergenic
1031238466 7:119208495-119208517 ACTAATATCCAGAATATGCAAGG + Intergenic
1031472267 7:122181224-122181246 ACTAATATCCAGAATATACAAGG - Intergenic
1031518338 7:122729718-122729740 ACTAATATCCAGAATATACAAGG - Intronic
1031700975 7:124926210-124926232 ACTAATATCCAGAATTTACAAGG + Intronic
1031902166 7:127423340-127423362 GCTAATATCCAGAATCTGCAAGG - Intronic
1032289118 7:130571307-130571329 ACTGATATCCAGAAACTACAAGG + Intronic
1032911872 7:136441655-136441677 ACTAATATCCAGAATCTACAAGG - Intergenic
1032935540 7:136727123-136727145 ACTAATATCCAGAATCTACAGGG + Intergenic
1033167169 7:139050097-139050119 ATTAATATCCAAAATATGTAAGG - Intronic
1033676861 7:143550193-143550215 ACTAATATCCAGAATATGCAAGG - Intergenic
1033690362 7:143730481-143730503 TCTGATATCCAGAATCTGCAAGG - Intergenic
1033694974 7:143779242-143779264 ACTAATATCCAGAATATGCAAGG + Intergenic
1033802470 7:144917520-144917542 ACTAATATGCAAAATATACAAGG - Intergenic
1033961159 7:146914676-146914698 ACTAATATCCAGAATCTACAAGG - Intronic
1034301794 7:150022348-150022370 ACTACTATCCAGAATGTACAAGG - Intergenic
1034386526 7:150745201-150745223 ACTGATTCCAAACATGTGCAGGG - Intronic
1034743481 7:153500255-153500277 ACTGATATCCAGAATCTGCAAGG - Intergenic
1034791034 7:153968433-153968455 TCTGATATCCACAATCTACAAGG - Intronic
1034804250 7:154074915-154074937 ACTACTATCCAGAATGTACAAGG + Intronic
1035124604 7:156599013-156599035 ACTGATATCCAGAATTTACAAGG + Intergenic
1035136880 7:156712108-156712130 ACTGATATCCAGAATTTACAAGG + Intronic
1035644497 8:1207945-1207967 ACTCATATCCAGAATCTTCAAGG - Intergenic
1036106907 8:5850838-5850860 ACTGATATCAAGAATCTACAAGG + Intergenic
1036775606 8:11610453-11610475 ACTAATATCCAAAATATATAAGG + Intergenic
1037365054 8:18113336-18113358 ACTAATATCCAGAATATACAAGG - Intergenic
1037642813 8:20763525-20763547 ACTAATATCCAAAATATATAAGG + Intergenic
1037719171 8:21428298-21428320 ACTCAACTCCAAAATGTGCAAGG - Intergenic
1037798996 8:22021499-22021521 ACTAATATCCAGAATATACAAGG + Intergenic
1038130859 8:24729812-24729834 ACTAATATCAGAAATCTGCAAGG - Intergenic
1038143746 8:24874571-24874593 ACTAATATCCAGAATCTACAGGG + Intergenic
1038173270 8:25158271-25158293 TCTGATATCCAGAATCTGTAAGG - Intergenic
1038682566 8:29682829-29682851 ACTAATATCCAGAATATGCAAGG - Intergenic
1038985926 8:32810339-32810361 GCTGATATCCAGAATCTACAAGG + Intergenic
1039034985 8:33350141-33350163 ACTAATATCCAGAATCTACAAGG - Intergenic
1039270524 8:35875450-35875472 ACTGATATCCAGAATCTACAAGG - Intergenic
1039332678 8:36556137-36556159 ACTGATATCCACAATTTACATGG + Intergenic
1039358499 8:36848174-36848196 ACTAATATCCAGAATATACAAGG - Intronic
1039672949 8:39624033-39624055 ACTAATATCCAAAATATACAAGG - Intronic
1039681690 8:39745244-39745266 ACTGATATCAAATATCTTCAGGG - Intronic
1039934165 8:42025634-42025656 ACTAATATCTAGAATGTACAAGG - Intronic
1040093007 8:43417886-43417908 ACTAATATCCAGAATATACAAGG - Intergenic
1040442400 8:47457475-47457497 ACTAATATCCAGAATCTACAAGG - Intronic
1040525755 8:48223342-48223364 ACTAATATCCAGAATCTACAAGG - Intergenic
1040703720 8:50099861-50099883 ATTAATATCCAAAATATACAAGG - Intronic
1040714873 8:50238754-50238776 TCTGATATCCAAAATGTACAAGG + Intronic
1040809772 8:51439186-51439208 ACTAATATCCAGAATCTACAAGG + Intronic
1040836795 8:51740707-51740729 TCTAATATCCATAATCTGCAAGG - Intronic
1040842380 8:51798445-51798467 CCTAATATCCAAAATCTGCAAGG + Intronic
1040933349 8:52758031-52758053 ACTAATATCCAGAATATACAAGG + Intergenic
1040966850 8:53090980-53091002 ACTAATATCCAGAATCTACAAGG - Intergenic
1041041378 8:53849589-53849611 ACTAATATCCAGAATCTACAAGG - Intergenic
1041434406 8:57821811-57821833 ACTAATATCCAGAATTTACAAGG + Intergenic
1041524869 8:58794094-58794116 ACTAATATCCAGAATCTACAAGG + Intergenic
1041577561 8:59417311-59417333 ACTAATATCCAGAATCTACAAGG + Intergenic
1041579189 8:59437534-59437556 ACTAATATCCAGAATCTACAAGG - Intergenic
1041610653 8:59843700-59843722 ACTAATATCCAGAATTTACAAGG + Intergenic
1041761470 8:61371371-61371393 ACTAATATCCAGAATCTACAAGG - Intronic
1041906752 8:63040925-63040947 ACTTATATCCAGAATGTACTGGG - Intergenic
1041910379 8:63082754-63082776 GCTAATATCCAGAATGTGCAAGG + Intronic
1041911317 8:63091557-63091579 TCTAATATCCAGAATCTGCAAGG + Intergenic
1042015882 8:64310554-64310576 ACAAATATCCAGAATCTGCAAGG + Intergenic
1042129432 8:65572548-65572570 ACTAATATCCAGAATATACAAGG - Intergenic
1042188462 8:66160900-66160922 ACTAATATCCAGAATCTACAAGG - Intronic
1042527544 8:69779918-69779940 ACTGATATCCAGAATTTATAAGG + Intronic
1042730528 8:71928791-71928813 GCTAATATCCAGAATATGCAAGG - Intronic
1042815103 8:72869457-72869479 ATTAATATCCAAAATATGTAAGG + Intronic
1042883772 8:73524424-73524446 ACGGATATGCAAAATGATCAGGG - Intronic
1042897245 8:73684721-73684743 ACTAATATCCAGAATCTACAAGG + Intronic
1042943742 8:74133903-74133925 ACTGATATCCAGAATCTATAAGG + Intergenic
1043001495 8:74765459-74765481 TCTCATATCCAGAATGTACAAGG + Intronic
1043177279 8:77037779-77037801 ACTAATATCCAGAATATACAAGG + Intergenic
1043202049 8:77382549-77382571 ACTAATATCCAGAATCTACAAGG + Intergenic
1043222009 8:77678116-77678138 GCTAATATCCAAAATATACAAGG + Intergenic
1043389237 8:79776127-79776149 ACTAATATCCAGAATTTACATGG - Intergenic
1043416438 8:80055651-80055673 ACTAATATCCAAAATATACAAGG + Intronic
1043448785 8:80345333-80345355 ACTAATATCCAGAATCTACAAGG - Intergenic
1043621781 8:82202295-82202317 AGTGATATCCACAATCTACAAGG + Intergenic
1043869500 8:85416308-85416330 ACTAATATCCAGAATCTACAAGG + Intronic
1043871041 8:85433180-85433202 ACTAATATCCAGAATGTATAAGG - Intronic
1043988303 8:86720259-86720281 ACTAATATCCAGAATCTGCAAGG + Intronic
1044054317 8:87549404-87549426 ACTAATATCCAAACTCTACAAGG - Intronic
1044074832 8:87807584-87807606 ACTAATATCCAGAATCTACAAGG + Intergenic
1044131405 8:88528280-88528302 GCTAATATCCAGAATCTGCAAGG + Intergenic
1044171078 8:89052560-89052582 ACTAATATCCAGAATCTACAAGG + Intergenic
1044312961 8:90716296-90716318 GCTCATATCCAGAATGTACAAGG - Intronic
1044551696 8:93519839-93519861 TCTAATATCCAGAATGTACAAGG - Intergenic
1044552474 8:93527470-93527492 ACTAATATCCAGAATCTACAAGG - Intergenic
1044563310 8:93635821-93635843 AGAAATATCCAAAATGTGGAGGG + Intergenic
1044787828 8:95814281-95814303 ACTAATATCCAGAATCTACAGGG - Intergenic
1045045396 8:98270559-98270581 ACTAATATCCAAAATCTATAAGG - Intronic
1045130905 8:99151255-99151277 ACTGTTACCCAAAATATACAAGG - Intronic
1045589046 8:103572784-103572806 ACTAATATCCAAAATCTATAAGG - Intronic
1045704997 8:104912077-104912099 TCTGATATCCAGAATCTACAAGG - Intronic
1045829685 8:106443955-106443977 TCTGATATCCAAAATTTAAAAGG + Intronic
1045868730 8:106900817-106900839 ACTAATATCCAGAATCTACAAGG - Intergenic
1046394980 8:113630394-113630416 ACTAATATCCAGAATCTACAAGG + Intergenic
1046421287 8:113986417-113986439 ACTAATATCCAGAATATTCAAGG + Intergenic
1046437017 8:114204022-114204044 ACTAATATCCAGGATGTACAAGG + Intergenic
1046441334 8:114258576-114258598 ACTAATATCCAAAATATACAAGG + Intergenic
1046449030 8:114363353-114363375 ACTAATATCCAGAATCTACAAGG + Intergenic
1046473751 8:114713543-114713565 ACTGATGTCCATACTCTGCATGG + Intergenic
1046827313 8:118705421-118705443 ACTAATATCCAAAATCTATAAGG - Intergenic
1046925803 8:119787165-119787187 GCTGATATCCAGAATCTACAAGG + Intronic
1047022575 8:120791554-120791576 ACTAATATCCAGAATCTACAAGG + Intronic
1047059735 8:121211473-121211495 ACTTATATCCAGAATCTACAAGG - Intergenic
1047226919 8:122963000-122963022 ACTAATATCCAGAATCTACAAGG - Intronic
1047345602 8:124025080-124025102 ACTAATATCCAGAATCTACAAGG - Intronic
1047368119 8:124231097-124231119 ACTAATATCCAGAATCTACAAGG - Intergenic
1047608255 8:126495980-126496002 ACTGATATGCATACTCTGCATGG - Intergenic
1047798362 8:128282185-128282207 ACTAATATCCAGAATCTACAAGG + Intergenic
1048285690 8:133139677-133139699 AGTGATATTCACAATCTGCAAGG + Intergenic
1048681394 8:136845281-136845303 ACTAATATCCAGAATCTACAAGG + Intergenic
1048811670 8:138293513-138293535 ACTAATATCCAGAATCTACAAGG + Intronic
1049633668 8:143673917-143673939 ACTCATATCCAAAATATCGAAGG + Intergenic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1050391721 9:5150355-5150377 ACTAATATCCAGAATCTACAAGG + Intronic
1050400700 9:5250510-5250532 ACTAATATCCAGAATCTACAAGG + Intergenic
1050428967 9:5542448-5542470 ACTAATATCCAGAATCTACAAGG + Intronic
1050475712 9:6038821-6038843 ACTAATATCCAGAATCTACAAGG - Intergenic
1050623983 9:7484144-7484166 GCTTATATCCAAAATCTACAAGG + Intergenic
1050941461 9:11464544-11464566 GCTAATATCCAAAATGTATAAGG - Intergenic
1051007041 9:12357907-12357929 ACTAATATCCAGAATCTACAAGG + Intergenic
1051199576 9:14601262-14601284 GCTAATATCCACAATGTACAAGG + Intergenic
1051227555 9:14917809-14917831 ATTAATATCCAAAATATACAAGG + Intergenic
1051570033 9:18545413-18545435 ACTGAGATCCAAAAAGTTTAAGG + Intronic
1051703572 9:19852205-19852227 TCTGATATCCAGAATCTACAAGG - Intergenic
1051803102 9:20959416-20959438 ACTAATATCCAGAATATGCAAGG - Intronic
1051926251 9:22330285-22330307 GCTAATATCCAGAATCTGCAAGG - Intergenic
1051981515 9:23025170-23025192 TCTAATATCCAAAATCTACAAGG - Intergenic
1052121181 9:24718757-24718779 ACTAATATCCAGAATCTACAAGG - Intergenic
1052141436 9:24990233-24990255 ACTAATATCCAGAATCTACAAGG + Intergenic
1052270372 9:26622185-26622207 GCTAATATCCAAAATCTACAAGG + Intergenic
1052547129 9:29893856-29893878 GCTAATATCCAGAATGTACAAGG + Intergenic
1052554203 9:29992791-29992813 GCTAATATCCAAAATCTACAAGG - Intergenic
1052588336 9:30457926-30457948 ACTAATATCCAGGATTTGCAAGG + Intergenic
1052692258 9:31830052-31830074 ATTAATATCCAAAATTTGTAAGG + Intergenic
1053188929 9:36043398-36043420 ACTAATATCCAGAATCTACAAGG - Intronic
1053326525 9:37157555-37157577 ACTAATATCTAAAATGTATAAGG + Intronic
1053672796 9:40385710-40385732 ACTAATATCCAAAACCTACAAGG + Intergenic
1053922612 9:43012091-43012113 ACTAATATCCAAAACCTACAAGG + Intergenic
1054383908 9:64525772-64525794 ACTAATATCCAAAACCTACAAGG + Intergenic
1054511829 9:65990573-65990595 ACTAATATCCAAAACCTACAAGG - Intergenic
1054991861 9:71337197-71337219 GCTAATATCCAGAATGTACAAGG + Intronic
1055195462 9:73587447-73587469 TCTAATATCCAGAATGTACAAGG + Intergenic
1055340288 9:75274158-75274180 ACTAATATCCAGAATCTGCAAGG - Intergenic
1055405744 9:75971803-75971825 GCTAATATCCAGAATCTGCAAGG - Intronic
1055543878 9:77346405-77346427 ACTAATATCCAGAATCTGTAAGG - Intronic
1055919720 9:81446843-81446865 ACTAATATCCAAAATCTACAAGG - Intergenic
1055996424 9:82165257-82165279 ACTAATATCCAGAATCTGTAAGG + Intergenic
1056027072 9:82509872-82509894 ACTGATATCCAGAATCTACAAGG + Intergenic
1056039151 9:82643107-82643129 ACTAATATCCAGAATGTAGAAGG + Intergenic
1056309841 9:85329277-85329299 ACTAATATCCAGAATCTACAAGG + Intergenic
1056342348 9:85649131-85649153 ACTGATTTTCAAAATGTCCTTGG + Intronic
1056456939 9:86769442-86769464 ACTGGTATCCAGAATCTACAAGG - Intergenic
1056696598 9:88861111-88861133 ACTAATATCCAGAATTTACAAGG + Intergenic
1056948531 9:91022904-91022926 ACTAATATCCAGAATCTACAAGG + Intergenic
1057476138 9:95404292-95404314 ACTAATATCCAGAATCTACAAGG + Intergenic
1057932344 9:99205529-99205551 ACTAATATCCAGAATATACAAGG - Intergenic
1058029756 9:100182377-100182399 GCTAATATCCAGAATGTACAAGG + Intronic
1058112288 9:101044125-101044147 ACTAATATCCAGAATCTACAAGG + Intronic
1058159947 9:101558784-101558806 ACTAATATCCAGAATCTACAAGG - Intronic
1058238530 9:102524798-102524820 ACTGGTATCCAGAATCTACAAGG - Intergenic
1058275117 9:103030857-103030879 AGTAATATCCAAAATATACAAGG + Intergenic
1058352835 9:104046704-104046726 ACTAATATCCAGAATATACATGG + Intergenic
1058398627 9:104587186-104587208 AGAAATATCCAAAATGTGAATGG - Intergenic
1058526371 9:105863287-105863309 ACTAATATCCAGAATCTACAGGG + Intergenic
1058764887 9:108172507-108172529 ACTAATATCCAGAATCTACAAGG - Intergenic
1059016918 9:110528687-110528709 ACTAATATCCAGAATGCACAAGG - Intronic
1059076801 9:111201787-111201809 GCTGATATCCAGAATCTACAAGG + Intergenic
1059573399 9:115464844-115464866 ACTAATATCCAGAATCTACAAGG + Intergenic
1059608130 9:115858769-115858791 GCTAATATCCAAAATCTACAAGG - Intergenic
1059674185 9:116521765-116521787 ACTAATATCCAGAATCTACAAGG + Intronic
1060564886 9:124581689-124581711 TCTGATATCCAGAATCTACAAGG + Intronic
1061030957 9:128082617-128082639 GCAGATGTACAAAATGTGCAAGG - Intronic
1062728171 9:138090660-138090682 ATTAATATCCAAAATATACAAGG + Intronic
1203446407 Un_GL000219v1:61059-61081 ACTAATAGCCAGAATCTGCAAGG + Intergenic
1185668235 X:1785444-1785466 ACTAAAATACAAAATGAGCATGG - Intergenic
1186348910 X:8723321-8723343 ACTAATATCCAGAATCTACAAGG + Intronic
1186431398 X:9508205-9508227 TCTAATATCCAGAATTTGCAAGG + Intronic
1186532109 X:10307399-10307421 ACTAATATCCAAAATTTACAAGG - Intergenic
1186586525 X:10879868-10879890 ACTGATTTTCAAGATGTGCCAGG + Intergenic
1186683693 X:11901979-11902001 ACTAATATCCAGAATCTGTAAGG - Intergenic
1186920874 X:14278750-14278772 ACTAATATCCAGAATGTACAAGG + Intergenic
1187214247 X:17260622-17260644 ACTAATATCCAAAATATATAAGG + Intergenic
1187305576 X:18092416-18092438 ATTAATATCCAGAATATGCAAGG - Intergenic
1187589265 X:20698403-20698425 ACTAATATCCAGAATCTACAAGG + Intergenic
1187632609 X:21191621-21191643 ACTAATATCCAGAATTTACAAGG + Intergenic
1187660047 X:21534814-21534836 ACTAATATCCAGAATATGCAAGG - Intronic
1187695717 X:21917812-21917834 ACTAATATCCAGAATCTACAGGG - Intergenic
1187849113 X:23573791-23573813 ACTAATATCCAGAATCTACAAGG + Intergenic
1188080367 X:25831553-25831575 ACTAATATCCAGAATCTACAAGG - Intergenic
1188272161 X:28153306-28153328 ACTAATATCCAGAATGTACAAGG + Intergenic
1188560744 X:31466056-31466078 GCTGATATCCAGAATCTACAAGG - Intronic
1188579608 X:31694503-31694525 GCTAATATCCAAAATATACAAGG + Intronic
1188778811 X:34254497-34254519 ACTAATATCCAGAATCTACAAGG - Intergenic
1188845842 X:35071087-35071109 TCTAATATCCAAAATCTACAAGG - Intergenic
1188927010 X:36056036-36056058 ACTAATATCCAGAGTGTACAAGG - Intronic
1188995228 X:36876767-36876789 ACTAATATCCAAAATATATAAGG + Intergenic
1189129866 X:38486613-38486635 ACTAATACCCAGAATGTACATGG - Intronic
1189734105 X:44051750-44051772 GCTGATATCCAGAATCTACAAGG - Intergenic
1189817473 X:44838457-44838479 ACTAATATCCAGAATCTACAAGG + Intergenic
1189836102 X:45024520-45024542 ACTAATATCCAGAATCTACAAGG - Intronic
1189874593 X:45422524-45422546 TCTGATATCCAGAATGTATAAGG + Intergenic
1190373963 X:49770586-49770608 TCTAATATCCAGAATGTACAAGG - Intergenic
1190428584 X:50355781-50355803 ACTAATATCCAGAATCTACAAGG - Intergenic
1190616197 X:52235364-52235386 ACAGATATCCAGAATTTACAAGG - Intergenic
1190896922 X:54628745-54628767 ACTAATATCCAAAATTTACAAGG - Intergenic
1190926622 X:54912388-54912410 ACTAATATCCAGAATCTACAAGG + Intergenic
1190926711 X:54913871-54913893 ACTAATATCCAGAATCTACAAGG - Intergenic
1190941247 X:55043450-55043472 ACTAATATCCAGAATCTACAGGG + Intergenic
1191045723 X:56134763-56134785 ACTAATATCCAGAATCTACAAGG + Intergenic
1191146521 X:57171640-57171662 ACTAATATCCAGAATCTACAAGG - Intergenic
1191168104 X:57413102-57413124 GCTGATATCCAGAATCTACAAGG - Intronic
1191208558 X:57860250-57860272 GCTAATATCCAGAATGTACAAGG + Intergenic
1191629652 X:63309043-63309065 ACTAATATCCAGAATATACAAGG + Intergenic
1191657764 X:63617038-63617060 ACTAATATCCAGAATCTACAAGG + Intergenic
1191694317 X:63973765-63973787 ACTAATATACAAAATTTACAAGG + Intergenic
1191803237 X:65104524-65104546 TTTGATATCCAAAATCTACAAGG + Intergenic
1191820213 X:65298259-65298281 ACTAATATCCAGAATCTACAAGG + Intergenic
1191950702 X:66588926-66588948 ACTGATATCCAGAATCCACAAGG - Intergenic
1191963619 X:66730698-66730720 ACTAATATCCAGAATCTACAAGG - Intergenic
1191994977 X:67084053-67084075 ACTAATATCCAGAATATACAAGG - Intergenic
1191997274 X:67108967-67108989 ACTAATATCCAGAATCTACAAGG - Intergenic
1192132592 X:68566881-68566903 ACTAATATCCAGAATCTACAAGG - Intergenic
1192531023 X:71885792-71885814 ACTAATATCCAGAATCTACAAGG - Intergenic
1192629646 X:72767303-72767325 ACTAATATCCAGAATCTACAAGG + Intergenic
1192652064 X:72953501-72953523 ACTAATATCCAGAATCTACAAGG - Intergenic
1192666443 X:73092683-73092705 ACTAATATCCAGAATCTACAAGG - Intergenic
1192877010 X:75241186-75241208 ACTAATATCCAGAATCTCCAAGG + Intergenic
1192901229 X:75499389-75499411 ACTAATATCCAGAATCTACAAGG + Intronic
1192904410 X:75535236-75535258 ACTAATATCCAGAATCTACAAGG - Intergenic
1192957634 X:76090121-76090143 GCTAATATCCAGAATCTGCAAGG - Intergenic
1192961318 X:76134118-76134140 ACTGATATCTAAAATCCACAAGG + Intergenic
1192985031 X:76389109-76389131 ACTAATATCCAAAATCTACAAGG - Intergenic
1193006779 X:76627850-76627872 ACTAATATCCAGAATCTACAAGG + Intergenic
1193072931 X:77325585-77325607 ACTAATATCCAAAATACACAAGG + Intergenic
1193078370 X:77380081-77380103 ACTAATATCCAGAATCTACAAGG + Intergenic
1193100357 X:77604258-77604280 ACTGATATCTAGAATTTACAAGG + Intronic
1193162975 X:78248978-78249000 ACAGATATCCATAATTTACAAGG - Intergenic
1193296924 X:79844411-79844433 GCTGATATCCAGAATCTACAAGG + Intergenic
1193303333 X:79919587-79919609 ACTAATATCCAGAATCTACAAGG + Intergenic
1193313882 X:80041994-80042016 ACTAATATCCAAAATATACAAGG - Intergenic
1193353634 X:80490548-80490570 ACTTATATCCAGAATCTACAAGG - Intergenic
1193375314 X:80753082-80753104 ACTAATAACCAAAATATACAAGG - Intronic
1193397886 X:81006993-81007015 ACTAATATCCAGAATCTACAAGG - Intergenic
1193400803 X:81039868-81039890 TCTAATATCCAAAATCTACAAGG + Intergenic
1193404114 X:81081710-81081732 ACTAATATCCAGAATCTACAAGG + Intergenic
1193451350 X:81672019-81672041 ACTAATATCCAGAATCTGCAAGG + Intergenic
1193486772 X:82093682-82093704 ACTAATATCCAGAATGTACAAGG - Intergenic
1193493380 X:82179040-82179062 ACTAATATCCAGAATATACAAGG - Intergenic
1193575653 X:83192675-83192697 ACTAATATCCAAAATCTACAAGG + Intergenic
1193590968 X:83388537-83388559 ACTAATATCCAGAATCTACAAGG + Intergenic
1193618914 X:83726552-83726574 ACTAATATCCATAATCTACAAGG + Intergenic
1193671482 X:84391818-84391840 ACTAATATCCAGAATATACAAGG - Intronic
1193693449 X:84677694-84677716 ACTAATAACCAAAATGAACAGGG - Intergenic
1193736771 X:85166387-85166409 ACTAATATCCAGAATCTACAAGG + Intergenic
1193737938 X:85182962-85182984 ATTAATATCCAAAATGCACAAGG - Intergenic
1193775577 X:85637059-85637081 ACTAATATCCAGAATCTACAAGG - Intergenic
1193828141 X:86252221-86252243 ACTAATATCCAGAATTTACAAGG - Intronic
1193874730 X:86848426-86848448 ACTTATATCCAGAATTTACAAGG - Intergenic
1193874909 X:86850307-86850329 ACTAATATCCAGAATCTACAAGG - Intergenic
1193933920 X:87591529-87591551 ATTGATATCCAGAATATACAAGG - Intronic
1193940099 X:87672279-87672301 ACAGTTATCCAAAATATACATGG + Intergenic
1193965504 X:87980627-87980649 ACTAATATCCAGAATCTACAAGG + Intergenic
1194012318 X:88577701-88577723 ACTAATATCCAGAATCTACAAGG + Intergenic
1194058773 X:89170685-89170707 GCTAATATCCAGAATGTACAAGG + Intergenic
1194104190 X:89748024-89748046 ACTAATATCCAGAATCTACAAGG - Intergenic
1194136964 X:90157023-90157045 ACTAATAACCAGAATATGCAAGG + Intergenic
1194146534 X:90272292-90272314 ACTAATATCCAGAATTTACAAGG + Intergenic
1194165791 X:90513618-90513640 ACTAATATCCAGAATCTACAAGG + Intergenic
1194194365 X:90873258-90873280 TCTTATATCCAAAATCTACAAGG + Intergenic
1194213902 X:91104763-91104785 ACCAATATCCAGAATGTACAAGG - Intergenic
1194228484 X:91292309-91292331 ACTAATATCCAGAATCTACAAGG - Intergenic
1194239509 X:91427074-91427096 ACTAATATCCACAATCTACAAGG + Intergenic
1194241965 X:91460785-91460807 ACTAATATCCAGAATCTACAAGG + Intergenic
1194251624 X:91582814-91582836 ACTAATATCCAGAATATACAAGG - Intergenic
1194263046 X:91721343-91721365 ACTAATATCCAGAAAGTACAAGG + Intergenic
1194287260 X:92025238-92025260 TCTAATATCCAGAATCTGCAAGG + Intronic
1194298867 X:92161048-92161070 ACTAATATCCAGAATCTACAAGG - Intronic
1194310198 X:92297026-92297048 TCTAATATCCATAATCTGCAAGG - Intronic
1194454198 X:94081863-94081885 ACTAATATCCACAATCTACAAGG + Intergenic
1194471067 X:94297545-94297567 ACTAATGTCCAGAATCTGCAAGG - Intergenic
1194485544 X:94481413-94481435 TCTAATATCCAAAATCTACAAGG - Intergenic
1194583132 X:95700730-95700752 ACTAATATCCAGAATCTACAGGG - Intergenic
1194627080 X:96237956-96237978 GCTAATATCCAGAATGTACAAGG - Intergenic
1194631765 X:96294033-96294055 GCTAATATCCAGAATGTACAAGG + Intergenic
1194827448 X:98580111-98580133 ACTAATATCCAAAATTTACAAGG - Intergenic
1194881474 X:99256976-99256998 ACTAATATCCAGAATCTACAGGG - Intergenic
1194967763 X:100308640-100308662 ACTAATATCCAGAATCTACAAGG + Intronic
1195059065 X:101176653-101176675 ACTAATATCCCAAATATACAAGG - Intergenic
1195126960 X:101817456-101817478 TCTAATATCCAAAATCTGCAAGG - Intergenic
1195149958 X:102057106-102057128 ACTAATATCCAGAATCTACAAGG - Intergenic
1195226821 X:102804252-102804274 ACTAATATCCAGAATCTACAAGG - Intergenic
1195259653 X:103119565-103119587 ACTAATATACAAAATCTACAAGG - Intergenic
1195686671 X:107593273-107593295 ACTAATATCCAGAATCTACAAGG - Intronic
1195730467 X:107961663-107961685 ATTAATATGCAAAATGTACAAGG - Intergenic
1195812372 X:108848590-108848612 ACTAATATCCAGAATCTACAAGG + Intergenic
1195912975 X:109907319-109907341 ACTAATATCCAGAATCTACAAGG - Intergenic
1195987866 X:110650556-110650578 ACTAATATCCAGAATATACAAGG - Intergenic
1196027568 X:111057073-111057095 ACTAATATCCAGAATCTACAAGG + Intronic
1196232285 X:113238221-113238243 TCTAATATCCAGAATCTGCAAGG - Intergenic
1196233900 X:113256787-113256809 TCTAATATCCAAAATCTACAAGG - Intergenic
1196251014 X:113459947-113459969 CATGATCTCCAAAATGTCCAGGG + Intergenic
1196460634 X:115925820-115925842 ACTAATATCCAGAATATACAAGG + Intergenic
1196517762 X:116633323-116633345 TCTAATATCCAGAATCTGCAAGG + Intergenic
1196518950 X:116649838-116649860 ACTAATATCTAGAATCTGCAAGG - Intergenic
1196521705 X:116681653-116681675 ACTAATATCCAGAATCTACAAGG + Intergenic
1196565651 X:117201542-117201564 ACTAATATCCAGAATTTACAAGG - Intergenic
1196620036 X:117811041-117811063 ACTAATATCCAGAATCTGCAAGG + Intergenic
1196621028 X:117823906-117823928 ACTAATACCCACAATCTGCAAGG - Intergenic
1196947764 X:120844869-120844891 ACTAATATCCAGAATCTACAAGG - Intergenic
1196994060 X:121361597-121361619 ACTAATATCCAGAATCTACAAGG - Intergenic
1197022580 X:121709570-121709592 TCTAATATCCAAAATCTACAAGG - Intergenic
1197045958 X:121998917-121998939 TCTAATATCCAGAATGTACAAGG - Intergenic
1197051684 X:122066637-122066659 GCTGATATCCTAAATCTACAAGG + Intergenic
1197060147 X:122169097-122169119 ACTAATATCCAGAATCTACAAGG + Intergenic
1197086600 X:122483807-122483829 ACTGATATCCAGAATTTATAAGG + Intergenic
1197087120 X:122491835-122491857 ACTAATATCCAGAATCTACAAGG - Intergenic
1197103769 X:122688787-122688809 ACTAATATCCAGAATCTACAAGG + Intergenic
1197110501 X:122768359-122768381 ACTGAAATCCAGAATCTGTAAGG + Intergenic
1197166787 X:123386336-123386358 ACTAATATCCAGAATATACAAGG - Intronic
1197297351 X:124735207-124735229 ACTAATATCCAGAATCTACAAGG + Intronic
1197324116 X:125070405-125070427 TCTAATATCCAAAATCTACAAGG - Intergenic
1197441863 X:126501274-126501296 ACTAATATCCAGAATCTGCAAGG - Intergenic
1197484816 X:127035831-127035853 ACTAATATCAAGAATTTGCAAGG + Intergenic
1197487478 X:127071803-127071825 ACTAATATCCAGAATCTACAAGG - Intergenic
1197530489 X:127617891-127617913 ATTAATATCCAAAATATGCAAGG + Intergenic
1197571735 X:128158076-128158098 ATTAATATCCAGAATCTGCAAGG - Intergenic
1197576131 X:128213836-128213858 ACTAATATCCAGAATCTACAAGG + Intergenic
1197584503 X:128328360-128328382 ACTAATATCCAGAATCTACAAGG - Intergenic
1197591247 X:128413310-128413332 ACTAATATCCAGAATCTACAAGG - Intergenic
1197878831 X:131142992-131143014 ACTAATATCCAGAATCTACAAGG + Intergenic
1198222494 X:134615462-134615484 GCTAATATCCAAAATATGTAAGG - Intronic
1198490437 X:137134723-137134745 GCTGATATCCAGAATCTGCAAGG + Intergenic
1198519569 X:137439093-137439115 ACTAATATCCAGAATCTACAAGG + Intergenic
1198550429 X:137739579-137739601 ACTGATACCCAGAATATACAAGG - Intergenic
1198640882 X:138755237-138755259 TTTAATATCCACAATGTGCAAGG - Intronic
1198668664 X:139053632-139053654 ACTAATATCCAGAATCTACAAGG - Intronic
1198695810 X:139336166-139336188 ACTAATATCCAGAATCTACAAGG - Intergenic
1198698702 X:139372931-139372953 GCTGATATCCAGAATGTACAAGG - Intergenic
1198813394 X:140559955-140559977 ACTAATATCCAGAATATACAAGG - Intergenic
1198833403 X:140776041-140776063 TCTAATATCCAGAATCTGCAAGG + Intergenic
1198935448 X:141898817-141898839 ATTGATACCCAACATCTGCAAGG + Intergenic
1198989683 X:142497440-142497462 GCTGATATCCAGAATCTACAAGG - Intergenic
1199010896 X:142757546-142757568 ACTAATATCCAGAATCTACAAGG - Intergenic
1199026914 X:142950359-142950381 TCTAATATCCAGACTGTGCAAGG - Intergenic
1199124232 X:144095610-144095632 ACTGATATCCAGAGTATACAAGG + Intergenic
1199262103 X:145787188-145787210 ACTGAACTCAAAAATGAGCAAGG + Intergenic
1199324692 X:146483916-146483938 ACTAAAATCAAAAATATGCAAGG - Intergenic
1199469359 X:148177020-148177042 ACTAATATCCAGAATCTACAAGG - Intergenic
1199490449 X:148393045-148393067 ACTAATATCCAGAATATACAAGG + Intergenic
1199657232 X:150008146-150008168 TCTGGAATCCAAAATTTGCATGG - Intergenic
1199781355 X:151063396-151063418 GCTAATATCCAAAATATACAAGG - Intergenic
1199821116 X:151447852-151447874 ACTGATATCCAGAATTTATAAGG + Intergenic
1199865158 X:151840478-151840500 ACTAATATCCAGAATCTACAAGG + Intergenic
1199911354 X:152290392-152290414 GCTGATATCCAGAATCTACAAGG - Intronic
1199915011 X:152329959-152329981 GCTGATATCCAGAATCTACAAGG + Intronic
1199925667 X:152460958-152460980 TCTAATATCCAGAATGTACAAGG - Intergenic
1199928254 X:152492353-152492375 ACTAATATCCAGAATCTACAGGG - Intergenic
1199946383 X:152671751-152671773 GCTAATATCCAAAATATACAAGG + Intergenic
1200031562 X:153300746-153300768 ACTGATATCCAGAATATACAAGG + Intergenic
1200284683 X:154808938-154808960 ACTAATATCCAGAATCTACAAGG + Intronic
1200330886 X:155296609-155296631 ACTAATATCCAGAATATACAAGG + Intronic
1200342849 X:155417321-155417343 GCTAATATCCAAAATATGTAAGG + Intergenic
1200456143 Y:3395833-3395855 ACTAATATCCAGAATCTACAAGG - Intergenic
1200482703 Y:3726965-3726987 ACTAATAACCAGAATATGCAAGG + Intergenic
1200492275 Y:3841473-3841495 ACTAATATCCAGAATTTACAAGG + Intergenic
1200503643 Y:3983792-3983814 ATTAATATCCAAAATATGTAAGG - Intergenic
1200512062 Y:4091410-4091432 ACTAATATCCAGAATCTACAAGG + Intergenic
1200540979 Y:4455649-4455671 TCTTATATCCAAAATCTACAAGG + Intergenic
1200570561 Y:4824046-4824068 ACTAATATCCAGAATATACAAGG - Intergenic
1200604797 Y:5249807-5249829 TCTAATATCCAGAATCTGCAAGG + Intronic
1200616473 Y:5385886-5385908 ACTAATATCCAGAATCTACAAGG - Intronic
1200618489 Y:5411313-5411335 TCTAATATCCATAATCTGCAAGG - Intronic
1200730944 Y:6739311-6739333 ACTAATATCCAGAATCTACAAGG - Intergenic
1201930094 Y:19334889-19334911 GCTAATATCCAGAATCTGCAAGG - Intergenic
1202018508 Y:20437131-20437153 ATTGATAACCAAAATGTATAAGG + Intergenic