ID: 1002976431

View in Genome Browser
Species Human (GRCh38)
Location 6:2082453-2082475
Sequence CCCATGCCTGCAATTTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002976431_1002976434 10 Left 1002976431 6:2082453-2082475 CCTCATAAAATTGCAGGCATGGG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1002976434 6:2082486-2082508 GTCCCCTCCATGTTACAATGAGG 0: 1
1: 0
2: 0
3: 5
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002976431 Original CRISPR CCCATGCCTGCAATTTTATG AGG (reversed) Intronic
902665051 1:17931551-17931573 CCTGTGCCTGCCATTCTATGTGG + Intergenic
903315679 1:22503326-22503348 GTCATGCCAGCAGTTTTATGAGG - Intronic
903745545 1:25584378-25584400 CACATGCCTGCCATTTGCTGAGG - Intergenic
906331631 1:44889934-44889956 CCCATTCCTGGGGTTTTATGAGG - Intronic
907598226 1:55740145-55740167 CCCTTGCCTGCCTTTTTATGGGG + Intergenic
909777789 1:79504992-79505014 CCTATGCTTGTGATTTTATGTGG + Intergenic
911709661 1:101055403-101055425 CACATGCCTGTAGTTTTAGGAGG + Intergenic
915362875 1:155296169-155296191 CCCATGCCTGCACTGCTATGGGG + Intronic
916637288 1:166686373-166686395 CCTTTGCCTGCATTTTAATGGGG + Intergenic
918550840 1:185740507-185740529 TCCATGCCAAAAATTTTATGTGG + Intronic
921605861 1:217153888-217153910 CCCATGCCTTCAACTTGATCAGG + Intergenic
922990973 1:229911039-229911061 CCCATCTCTGCAATATTTTGTGG + Intergenic
924443574 1:244107013-244107035 CCCATGCCTGGAAGCTTGTGAGG + Intergenic
924889692 1:248261271-248261293 CCTTTGCCTACATTTTTATGGGG - Intergenic
1063700475 10:8379757-8379779 CCTATGCTTGCCATTTTGTGGGG - Intergenic
1064320968 10:14304288-14304310 CCAATACCTGCTATTTTCTGTGG + Intronic
1065662215 10:28017770-28017792 GCCATGACTACAATTTTATTTGG - Intergenic
1067192409 10:44082455-44082477 CCCGTGCCAGCAAGTTTGTGTGG + Intergenic
1068725882 10:60302375-60302397 CGTATACCAGCAATTTTATGTGG + Intronic
1069416146 10:68202490-68202512 CCCATGTCTTCAATTATATCAGG + Intronic
1071316244 10:84401774-84401796 TGCATGCTTGTAATTTTATGTGG + Intronic
1072111837 10:92329439-92329461 TTCATGGCTTCAATTTTATGGGG + Intronic
1075151666 10:119938307-119938329 CCCATCCCTGCAAATTTTGGGGG - Intronic
1075215001 10:120524674-120524696 CCCATGGCAGCGTTTTTATGGGG + Intronic
1075957259 10:126534753-126534775 CCCATTCCTTCAATTTGCTGAGG - Intronic
1079513098 11:21234186-21234208 CCCATGCTTGCATTTTTCTCTGG - Intronic
1081413537 11:42787220-42787242 CAAATGCCTGCAATTTCCTGTGG - Intergenic
1082823161 11:57558516-57558538 TCCATCTCTGCAATTTTAAGAGG + Intronic
1083020803 11:59504836-59504858 CTCATGCCTGTAATTTTTTTGGG + Intergenic
1088805088 11:113345160-113345182 TGCATGCCAGCCATTTTATGTGG + Intronic
1094317903 12:29152209-29152231 CCAATGACTGAAATTTTTTGAGG + Intronic
1094476920 12:30847673-30847695 CGCATGACTGCTATTTTTTGTGG - Intergenic
1095052243 12:37564863-37564885 CCTATTTCTGCAATTTTATAAGG - Intergenic
1098071129 12:66675827-66675849 CCCATGCCTGCCATTATGAGAGG - Intronic
1098197820 12:68020576-68020598 TGCATGTCTGAAATTTTATGTGG - Intergenic
1102723624 12:115039142-115039164 CCCATGCCTGCAATTCTAGAGGG - Intergenic
1104619134 12:130297433-130297455 CACAGGCCTCCAATTTTTTGGGG - Intergenic
1107284327 13:38773269-38773291 CCCATGCCTCCAAGTGTCTGTGG + Intronic
1107448023 13:40485337-40485359 CCCATGCCTGCCACTTCCTGCGG - Intergenic
1109007291 13:56894184-56894206 CCCACTCCTGCAATCTTATTGGG + Intergenic
1109660571 13:65454072-65454094 AACAGGCCTGCAGTTTTATGTGG - Intergenic
1109770050 13:66958432-66958454 GACATGCCTTAAATTTTATGAGG + Intronic
1110396429 13:75034688-75034710 CCTATGCCAATAATTTTATGCGG + Intergenic
1111162415 13:84413212-84413234 CGCATGACTGCAATTATGTGTGG - Intergenic
1113425452 13:110204415-110204437 CCCTTGGCTGTAATTTTTTGAGG - Intronic
1114802420 14:25792522-25792544 TCCAAGCCTCCTATTTTATGTGG + Intergenic
1116780157 14:49228097-49228119 CCCATTCCTGCAGTTTGATGAGG - Intergenic
1117399663 14:55347236-55347258 CCCATGCCTGCCTTTGTGTGTGG + Intronic
1120747742 14:88167110-88167132 CCCATTCCTTCTATTATATGTGG + Intergenic
1124871062 15:33543198-33543220 CCCATGACTGCAATCTGATTTGG + Intronic
1127633794 15:60850327-60850349 CCCATGCCTGCAAATTAGAGGGG - Intronic
1129043993 15:72717014-72717036 GCAATGCCTGCAAAGTTATGAGG - Intronic
1132112015 15:99108466-99108488 CCCAAGCCTGTAATTTTTTTCGG + Intronic
1134404937 16:13948370-13948392 CCCATGCCTGTACTTTTCAGCGG + Exonic
1135068025 16:19327389-19327411 CTCATGCCTGTAATTTGAGGTGG - Intergenic
1138065190 16:53933499-53933521 CCCATGCCAGCAATGTTTTGTGG - Intronic
1140672324 16:77291566-77291588 CCCATCCCTCCTATTTCATGTGG - Intronic
1142110801 16:88330040-88330062 CCTATGCCTGGCATTTCATGTGG - Intergenic
1143416356 17:6753796-6753818 CCCATGCCTGTGATTGGATGGGG + Intergenic
1144008951 17:11127123-11127145 TCCCTGCTTGCAATTTTTTGGGG - Intergenic
1145372743 17:22320748-22320770 CCTATTTCTGCAATTTTATAGGG - Intergenic
1149040467 17:52182234-52182256 ACCCTCCCTGCAGTTTTATGGGG + Intergenic
1149291955 17:55225947-55225969 CCCCTGCCTGCAGGTTAATGTGG - Intergenic
1151139266 17:71976087-71976109 CCCAAGCCTGCAGTTTCATGCGG + Intergenic
1153579860 18:6562027-6562049 CACATGCCAGCCATTTCATGTGG + Intronic
1154047824 18:10923763-10923785 CCCATGCCTGCAATTTCAGCAGG + Intronic
1154958437 18:21283174-21283196 CCTATGCATGGAATTTTCTGAGG - Intronic
1156967458 18:43112370-43112392 CCCATGCCTGCCATGCAATGGGG + Intronic
1159213803 18:65364108-65364130 CCCATACCTGGAATTCTCTGTGG - Intergenic
1161854747 19:6757647-6757669 CCCAAGCAAGCAATTTTAAGTGG - Intronic
1162577322 19:11506483-11506505 CCCATGCCTACACCTTTTTGAGG + Intronic
925154940 2:1641621-1641643 GCCATGCCTGGTATTTTAAGAGG + Intronic
929933663 2:46277627-46277649 CCCGAGCCTGCCATTTTCTGTGG - Intergenic
936691347 2:114892857-114892879 CCCATCACTGCCATTTTTTGGGG - Intronic
942152401 2:173090055-173090077 CCCATGTGTACTATTTTATGTGG - Intronic
942809288 2:179977724-179977746 CACATGCCTGTCATTTTTTGTGG - Intronic
946351580 2:219158467-219158489 TCCATGCCTTCTATTTTATCAGG - Intronic
947244222 2:228029270-228029292 CAGATGCCTGCAAATATATGGGG + Intronic
1172970255 20:38868003-38868025 CACAGGACTGCAATTTTAGGGGG - Intronic
1177084848 21:16690836-16690858 CCCATCCCAAAAATTTTATGAGG + Intergenic
1183099725 22:35576490-35576512 ACACTGCCTGCAATTTCATGGGG + Intergenic
950228072 3:11252330-11252352 CCCATGTCTTAAATTTTCTGTGG - Intronic
952482368 3:33774798-33774820 CTCATGCCTGTAACTTTAGGAGG + Intergenic
955491913 3:59491300-59491322 CCTTTGCCTACATTTTTATGGGG + Intergenic
955499496 3:59570077-59570099 CACATGCCTGCCTTTTTATAAGG + Intergenic
955531533 3:59878089-59878111 CTCATGGCTGCATTTATATGAGG - Intronic
956436607 3:69240223-69240245 CTCATGCCTGTAATTTTGGGAGG + Intronic
957038600 3:75318028-75318050 AGCATGCCTGCAATTTTAAAAGG - Intergenic
961978724 3:131054357-131054379 CTCAGGCCTGCAGATTTATGAGG - Intronic
962357154 3:134704646-134704668 CCCATGCCTGCTATTTGCAGAGG + Intronic
962437271 3:135378742-135378764 CACATTCCTTCAATTGTATGGGG - Intergenic
964200048 3:154108846-154108868 CCCATGCCTCCATTTCTTTGTGG - Intergenic
969137091 4:5038155-5038177 GGCATGCCAGGAATTTTATGGGG - Intergenic
970170605 4:13285624-13285646 CCCATGTCTGCTTTTTAATGAGG + Intergenic
970179650 4:13377619-13377641 CCCATGCCTTCCATTTCATTTGG - Intronic
971470946 4:27026574-27026596 CTCTTGCCTGTAATTTTTTGGGG - Intergenic
972104755 4:35469339-35469361 CCCATGCCTGGAATTTAGAGAGG - Intergenic
974052845 4:56957195-56957217 GCCATGCCTGCTATTTTCTAGGG + Intergenic
975256884 4:72247235-72247257 CCCATCTCTGCAAGTTTATTTGG - Intergenic
977801736 4:101242665-101242687 CTCATGCCTGTAATTTTGGGAGG + Intronic
985150138 4:186938543-186938565 GCCATGCCTCCAAGTTTCTGAGG - Intergenic
988566829 5:32325919-32325941 CTCCTGCCTGCACTTTTAAGTGG + Intergenic
989450280 5:41578533-41578555 CCACTGCCAGCAGTTTTATGGGG + Intergenic
989756109 5:44956818-44956840 CCCATGACTTCACTTATATGTGG - Intergenic
996766761 5:127042079-127042101 CTCATGCCTCCAGTTTTTTGTGG + Intergenic
996867364 5:128140704-128140726 TCTATGCCTGAAATTTTTTGGGG - Intronic
997062203 5:130519883-130519905 TGCATGCCTGCATTTTTGTGTGG - Intergenic
998617874 5:143760869-143760891 ACCTTGACTGCAACTTTATGAGG - Intergenic
998989165 5:147796008-147796030 CCTGTGCCTCCACTTTTATGTGG + Intergenic
1000180014 5:158799773-158799795 GCTAGGCCTGCATTTTTATGGGG - Intronic
1000958899 5:167575543-167575565 CCTATGAATCCAATTTTATGAGG + Intronic
1001515465 5:172352524-172352546 CCCATGCCTGCTATTTGATATGG + Intronic
1002976431 6:2082453-2082475 CCCATGCCTGCAATTTTATGAGG - Intronic
1005760676 6:28964944-28964966 CCCATGCCTGCAATCTCTTTGGG + Intergenic
1006973880 6:38078069-38078091 CCCATGTCTTCAACTTTATAGGG + Intronic
1008434855 6:51464090-51464112 CCCATGCATGCTCTTTTATGAGG + Intergenic
1008453094 6:51675587-51675609 CCCCTGCCTGGATTTTCATGAGG - Intronic
1010726018 6:79334292-79334314 CGCATGTCTGAATTTTTATGTGG + Intergenic
1012950362 6:105511913-105511935 CTCATGCATGCAATTCTGTGTGG - Intergenic
1014271165 6:119337944-119337966 CCCAAGTCAGCAATTTTATAAGG - Intronic
1015037246 6:128670821-128670843 CCCTTGCCTGAAATAGTATGTGG + Intergenic
1021227407 7:18044256-18044278 CCCATTTCAGTAATTTTATGTGG - Intergenic
1021644099 7:22771000-22771022 CCTATGATTGCAATTCTATGAGG + Intergenic
1022911279 7:34901547-34901569 AGCATGCCTGCAATTGTATTAGG + Intergenic
1023498957 7:40828007-40828029 TCCATGCCTGGATTCTTATGTGG + Intronic
1023719919 7:43082298-43082320 ACCATGTCTGCAATTTGATTTGG - Intergenic
1027501715 7:78960176-78960198 CCCTTTCCTGCAGTTTTATCAGG - Intronic
1027846940 7:83392064-83392086 CCAATGCCTACAATTCTGTGAGG - Intronic
1028258754 7:88634318-88634340 TCCATTACTGCAATTTTATGTGG - Intergenic
1031360238 7:120840896-120840918 TCAATGGCTGCAATTTTATCAGG + Intronic
1043908005 8:85829941-85829963 CCCTTTCCTGAATTTTTATGAGG - Intergenic
1044386713 8:91597823-91597845 CCCATGGATGCACTTTAATGGGG + Intergenic
1047242493 8:123104701-123104723 CCTATACCTTCATTTTTATGGGG - Intronic
1053798027 9:41743799-41743821 CCTATTTCTGCAATTTTATAAGG + Intergenic
1054186441 9:61955852-61955874 CCTATTTCTGCAATTTTATAAGG + Intergenic
1054466908 9:65502198-65502220 CCTATTTCTGCAATTTTATAAGG - Intergenic
1054652063 9:67632672-67632694 CCTATTTCTGCAATTTTATAAGG - Intergenic
1056997314 9:91474979-91475001 ACCATCCCTGCAAGTTTGTGTGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057788508 9:98106481-98106503 CCTATGCCTGCACTCTCATGTGG - Intronic
1185832095 X:3311888-3311910 CCCATTCCTGCAAGTGTGTGTGG + Intronic
1186738177 X:12488553-12488575 CACATACCTGCATATTTATGGGG - Intronic
1187827122 X:23342815-23342837 CACATGCCTTCTACTTTATGAGG + Intronic
1190485688 X:50922619-50922641 CCCATGCCTTTTATTTTTTGAGG - Intergenic
1192206146 X:69097730-69097752 CACATGCCAGCAACTTGATGAGG + Intergenic
1192888176 X:75359757-75359779 CACATGCTTGTATTTTTATGTGG + Intergenic
1195281283 X:103336469-103336491 CCCATTACTGCACTTTTCTGTGG - Intergenic
1195295654 X:103473842-103473864 CTCATGCCTGCAGCTTTCTGAGG - Intergenic
1197615124 X:128682180-128682202 CAGATGCCTTCTATTTTATGGGG - Intergenic
1198186254 X:134256757-134256779 CTCATGCCTGCAACTTTATGGGG - Intergenic
1198433793 X:136594909-136594931 TCCATCCTTGCAAATTTATGTGG + Intergenic
1199984802 X:152942686-152942708 CCCATGCTTGCAACATAATGAGG - Intronic