ID: 1002984137

View in Genome Browser
Species Human (GRCh38)
Location 6:2171770-2171792
Sequence CACAAAGACTTCCATGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002984135_1002984137 22 Left 1002984135 6:2171725-2171747 CCAGAAGAAAGCATCAGGAAAGT 0: 1
1: 0
2: 2
3: 31
4: 300
Right 1002984137 6:2171770-2171792 CACAAAGACTTCCATGAAAAAGG 0: 1
1: 0
2: 3
3: 32
4: 308
1002984136_1002984137 -10 Left 1002984136 6:2171757-2171779 CCACATTAAAATGCACAAAGACT 0: 1
1: 0
2: 3
3: 36
4: 371
Right 1002984137 6:2171770-2171792 CACAAAGACTTCCATGAAAAAGG 0: 1
1: 0
2: 3
3: 32
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002984137 Original CRISPR CACAAAGACTTCCATGAAAA AGG Intronic
901581962 1:10251955-10251977 CACAAACTCTACCAAGAAAACGG - Intronic
905447138 1:38034791-38034813 CACAAAGAGTCCCATGCACAGGG - Intergenic
905846348 1:41236404-41236426 CAAAAAGACATCCAATAAAATGG + Intronic
906066181 1:42981979-42982001 CACATAGACTTCGATGTGAATGG + Intergenic
906134603 1:43488575-43488597 CACAAACTCTTCCAAGAAATAGG - Intergenic
907893080 1:58654506-58654528 CAAAAAGACTTCCAGGGTAATGG - Intergenic
909174590 1:72340192-72340214 CACAAAGACTTAACTCAAAATGG - Intergenic
909903500 1:81168005-81168027 GATAAAGACTTCCATGGAACAGG + Intergenic
910713863 1:90209113-90209135 AAGAAACACTTCCATGGAAAAGG + Intergenic
910984802 1:92994997-92995019 CACAAAGACCTGCATTAAAAAGG - Intergenic
911806783 1:102220290-102220312 CAGAAAGAGGTCCAAGAAAAGGG + Intergenic
911960312 1:104293866-104293888 CACAAACAATTTCATGAAGATGG - Intergenic
912927149 1:113923266-113923288 CACAGAGACCCACATGAAAAGGG - Intergenic
915089484 1:153414001-153414023 AACAAAGAATTCTAAGAAAAGGG - Intergenic
915096020 1:153463067-153463089 AACAAAGAATTCTAAGAAAAGGG + Intergenic
915270313 1:154749221-154749243 CACGAAGACTTCAATGTGAATGG + Intronic
915703115 1:157815958-157815980 TAAAAAGTCTTCCATCAAAAAGG + Intronic
917074783 1:171193015-171193037 CACAAAGACTGGCATTAAATAGG + Intronic
918348538 1:183629399-183629421 CAGAAAGTGTTCCATGAATAGGG + Intronic
918357706 1:183721301-183721323 CAAAAAGACTTACATGACAAGGG - Intronic
918590815 1:186238936-186238958 AACAAGGACTTCCATCAAGAAGG - Intergenic
918669191 1:187192921-187192943 CATAAAGATATCCATTAAAAGGG - Intergenic
918831944 1:189409504-189409526 CACAAAGACTGCACTGAAAATGG + Intergenic
920618764 1:207523600-207523622 CACAAGGAATTCCTGGAAAAAGG - Exonic
920620546 1:207542171-207542193 CACAAGGAATTCCTGGAAAAAGG - Exonic
920622328 1:207560728-207560750 CACAAGGAATTCCTGGAAAAAGG - Exonic
921168208 1:212522764-212522786 CTCACAGACTTCAAGGAAAAAGG - Intergenic
921496449 1:215847817-215847839 CACCAAGACTTTAATGTAAAGGG - Intronic
921500858 1:215901227-215901249 AACAAAGAGTTAAATGAAAAAGG - Intronic
921574062 1:216813675-216813697 CACTATGACATCCCTGAAAAAGG - Intronic
922035771 1:221846394-221846416 CACAACGACATCCATGCAAAAGG + Intergenic
923507268 1:234615483-234615505 CATAAAGACTAGCATAAAAATGG - Intergenic
924826825 1:247548402-247548424 CTCAAAGACTAACATGACAATGG - Intronic
1063023316 10:2152195-2152217 CACAAATAGATCCATGAAACAGG + Intergenic
1063074311 10:2699825-2699847 AACAAAGATTTTCATGAAACCGG - Intergenic
1063240562 10:4165343-4165365 CACAGAGACTTCCATGGAAAAGG - Intergenic
1063382350 10:5593643-5593665 CACAAAGACATCCAGGCAAATGG - Intergenic
1063591492 10:7399959-7399981 CACAAAAGCTTTCATCAAAAAGG + Intronic
1068345469 10:55772383-55772405 CACAAAAACTGCCATTAAAGTGG - Intergenic
1070861022 10:79661897-79661919 CACAAAAACTGCCATTAAACTGG + Intergenic
1070876240 10:79813688-79813710 CACAAAAACTGCCATTAAACTGG - Intergenic
1071322629 10:84479081-84479103 TATAAAGACTTCCATGAGGATGG - Intronic
1071643170 10:87335861-87335883 CACAAAAACTGCCATTAAACTGG - Intergenic
1072046930 10:91666637-91666659 CACACAGACCTCCCTGAAGAAGG - Intergenic
1072870458 10:99114514-99114536 CACAAAGACTTCTACAAACATGG + Intronic
1073753175 10:106552686-106552708 CACACTGAGTTTCATGAAAAAGG - Intergenic
1074451605 10:113563973-113563995 CACTAAGACTTCAAGGACAAAGG - Intronic
1075213869 10:120515190-120515212 CTCACAGACATCCAAGAAAAAGG + Intronic
1075797168 10:125128830-125128852 CAAAAAGACATGCATGAGAATGG + Intronic
1076030188 10:127150755-127150777 CACAAAATATTCAATGAAAAAGG + Intronic
1078632583 11:13016586-13016608 CACACAGTTTTCCATGCAAATGG - Intergenic
1078925019 11:15866771-15866793 CACAAACACTCCCAGAAAAATGG + Intergenic
1079963081 11:26947827-26947849 CAGGAATACTTCCATGAAAGAGG + Intergenic
1080148003 11:29011826-29011848 CCCATATACTTCCATGAATAAGG + Intergenic
1080334241 11:31177677-31177699 CACATAACATTCCATGAAAATGG + Intronic
1081351066 11:42052768-42052790 TAGAAAGATTTTCATGAAAAAGG + Intergenic
1082723518 11:56707381-56707403 CTCAAGGATTTACATGAAAAAGG + Intergenic
1084056955 11:66640381-66640403 CAGAAAGCCTTCAAAGAAAAGGG - Intronic
1085795028 11:79531422-79531444 TACAAGGTCATCCATGAAAAAGG - Intergenic
1085957808 11:81421539-81421561 TAAAAAGAATTCCTTGAAAATGG + Intergenic
1086885803 11:92204438-92204460 AACAAATACTTCCATTAAATAGG - Intergenic
1087165424 11:94998325-94998347 CACGAAGGCATCCATGGAAAAGG - Exonic
1087168419 11:95026501-95026523 CACAAAGGGGTCCATGGAAAAGG - Exonic
1087170268 11:95042928-95042950 CACAGAGACATCCATGATAAGGG - Intergenic
1087171017 11:95050365-95050387 CACGAAGGCATCCATGGAAAAGG - Intergenic
1088342474 11:108784278-108784300 TACAGAGTCTTCCAAGAAAAGGG - Intronic
1089636477 11:119816908-119816930 CATATAGACCTCCATGTAAATGG + Intergenic
1089801040 11:121027695-121027717 AACAAAGACTTCAAAGAAGAGGG - Intronic
1090453141 11:126824083-126824105 CACAAAGATCATCATGAAAAGGG - Intronic
1090802559 11:130181997-130182019 GACAGAGACTCCCATGAGAAGGG - Intronic
1091618845 12:2070345-2070367 CTCAAAGACTTTCTTGAAAATGG - Intronic
1091647254 12:2283316-2283338 CCCAAAGTCTCCCCTGAAAAAGG - Intronic
1092954636 12:13538401-13538423 AACAAAGACTCCAATGACAAGGG - Exonic
1093627564 12:21367455-21367477 GAGAAAGATTTCCATGAGAATGG + Intronic
1094631548 12:32180350-32180372 CACTTAAACTTCCATCAAAAGGG + Intronic
1094864665 12:34516957-34516979 CACAGAGCCCTACATGAAAAAGG - Intergenic
1098035206 12:66294704-66294726 CACACATACTTCCAGGAAGAAGG + Intergenic
1099190519 12:79557136-79557158 AACAATGACTTCCATGAGAGAGG + Intergenic
1100508422 12:95243748-95243770 CACCAAGCCATCCATGAAAGTGG - Intronic
1100592189 12:96039749-96039771 CACAAATGCTTCCCTTAAAAGGG + Intronic
1102392555 12:112561323-112561345 CACGCAGAATTCCCTGAAAAGGG - Intergenic
1103549357 12:121725509-121725531 CACACAGACTTACATGACATCGG + Intronic
1104531612 12:129576342-129576364 CAGAATGAGCTCCATGAAAATGG + Intronic
1104799970 12:131547807-131547829 CAGAAATCCTTCAATGAAAAAGG - Intergenic
1107154351 13:37148879-37148901 CATAAAGACTTTCATAAAAAGGG + Intergenic
1107401078 13:40069857-40069879 CATAATGACTTCCATGGCAATGG - Intergenic
1108108763 13:47044444-47044466 CACTCAGACTTCACTGAAAATGG + Intergenic
1109632497 13:65069194-65069216 CAGAAAGACTTCTAAGAGAATGG + Intergenic
1109966663 13:69707869-69707891 TACAAAGCCTGTCATGAAAAAGG + Intronic
1110015760 13:70399763-70399785 CACAAATATTTGCAAGAAAAGGG + Intergenic
1110698747 13:78522602-78522624 CAGTAAGAATACCATGAAAAAGG + Intergenic
1110763915 13:79261071-79261093 CACAAACACTTACAAGAAAAAGG + Intergenic
1110893171 13:80715350-80715372 CACAAAGACATCTTTAAAAATGG - Intergenic
1111254979 13:85655016-85655038 AAAAATGACTTCAATGAAAAAGG + Intergenic
1112500651 13:99940563-99940585 CACAAAGAGGACGATGAAAACGG + Intergenic
1112706592 13:102076659-102076681 CACAAATAAATCCATGAACATGG + Intronic
1112715630 13:102181642-102181664 CATAAAGACTTTTTTGAAAAGGG - Intronic
1115682269 14:35754268-35754290 TAAAAAGACTGCTATGAAAACGG + Intronic
1117647746 14:57869814-57869836 CAAAACAACTTCCCTGAAAATGG - Intronic
1118200772 14:63670323-63670345 TAAAAAGACTTCCATCAAAAGGG + Intergenic
1120339047 14:83195330-83195352 CACAAACACTTTCAAGAAAAAGG + Intergenic
1121062130 14:90922209-90922231 CACTAAGAGGTCAATGAAAAGGG - Intronic
1121083113 14:91124646-91124668 AACAAAGGCTTCTATGAAACAGG - Intronic
1121411360 14:93750604-93750626 CATACAGACTTCCATGGACAAGG - Intronic
1121589324 14:95089845-95089867 CACATAGTCTTGCATAAAAAAGG - Exonic
1121887256 14:97554922-97554944 TAAAAAGATTTCAATGAAAAGGG - Intergenic
1121966309 14:98309696-98309718 TACAAAGACATCCAGGAAGAAGG - Intergenic
1126930585 15:53645194-53645216 CAGAAAGACTTAGATGATAAAGG - Intronic
1128422101 15:67502737-67502759 CCCAAAAACTTCCTGGAAAACGG - Intergenic
1128816764 15:70615710-70615732 GACAAAGACTTCTCAGAAAAGGG + Intergenic
1129053684 15:72804705-72804727 CACAAAGAGAAACATGAAAATGG + Intergenic
1129176182 15:73841343-73841365 CAGAAAGACTGTCTTGAAAAGGG - Intergenic
1134427146 16:14160823-14160845 CACAAAAACCACCATGAAAGGGG - Intronic
1134916121 16:18072466-18072488 CACAGAGTCTTCCATCAAAGGGG + Intergenic
1135249199 16:20886269-20886291 CACAAAGACTTCATTGAATAAGG + Intronic
1135505187 16:23030209-23030231 CACAAAGACCTCCCTGAGATAGG - Intergenic
1137455861 16:48617331-48617353 CAGCAAGTGTTCCATGAAAAAGG - Intronic
1137702893 16:50509929-50509951 CACATAAACTACCATGCAAATGG - Intergenic
1137779654 16:51087259-51087281 CACAATGACTAACTTGAAAAGGG - Intergenic
1138776967 16:59734943-59734965 CATAAAGACTTACATGGAAATGG - Intronic
1139289379 16:65843703-65843725 CCCAAAGCCTTCCCTGGAAAGGG - Intergenic
1140753489 16:78046774-78046796 CACAAAAACTTTAATGAAACAGG - Intronic
1140772150 16:78214957-78214979 TACAGAGACTACCATGAGAATGG + Intronic
1141425333 16:83941066-83941088 CACAAAGACTCCCATGGGAACGG + Intronic
1141557025 16:84842993-84843015 CACTAAGTCTTGCATGAAACCGG - Intronic
1142500242 17:328160-328182 CATAGACACTGCCATGAAAATGG + Intronic
1144007857 17:11117507-11117529 CACAAAGACTTTCCTGAGCAAGG + Intergenic
1145064690 17:19754094-19754116 CACAAACCCTTCCAAGAAATGGG - Intergenic
1146051294 17:29555662-29555684 CTCAAAGACCTCCATGATGAAGG - Intergenic
1146327522 17:31899658-31899680 GATAAAGTCTTCCTTGAAAAGGG + Exonic
1146749375 17:35364077-35364099 CAAAAAGACTTCCAAGGCAAAGG + Intronic
1146886953 17:36477524-36477546 CACAAAGTCTTCTCTGCAAAAGG - Intergenic
1147858425 17:43500954-43500976 CACAAAGAATTATATGAAAAAGG - Intronic
1148028518 17:44604683-44604705 CAAAAAGGCTTCCATGAAAATGG - Intergenic
1149105589 17:52960396-52960418 CACAGAGCCTGACATGAAAAAGG - Intergenic
1150927675 17:69550786-69550808 CACAGAGACTTCCAGTTAAAAGG - Intergenic
1151201458 17:72470762-72470784 AACAAAATCTTACATGAAAATGG + Intergenic
1151416409 17:73968848-73968870 CACAAGGGCTTCCTTGAAACTGG + Intergenic
1155759031 18:29541139-29541161 CATAAACTCTTCTATGAAAAGGG + Intergenic
1155776271 18:29765859-29765881 TACAAATAATTCCATGTAAAAGG + Intergenic
1155853918 18:30808525-30808547 CAGAAAGACTTCGGAGAAAAAGG + Intergenic
1156694098 18:39746214-39746236 CACAAAGAAATTCATGATAAAGG + Intergenic
1157380759 18:47214018-47214040 CACAAGGAGTTCCAATAAAATGG + Intronic
1159621362 18:70642586-70642608 CAAAAACACTTCCATGCAAATGG + Exonic
1161945477 19:7433584-7433606 CACCAAAAATTACATGAAAACGG - Intronic
1163623843 19:18376884-18376906 GACAAAGACTTCCTTGAGATTGG + Intronic
1164193205 19:22930273-22930295 CACAATGCCTTCTATGAGAATGG - Intergenic
925694097 2:6556386-6556408 CAGAAAGACATCCATACAAAGGG - Intergenic
926862091 2:17320546-17320568 CACTCAGACTTCAATGGAAAAGG + Intergenic
926939256 2:18117796-18117818 CACAAAGACTACAAAGTAAATGG - Intronic
927585386 2:24298967-24298989 CTTAAAGACTTCCAAGAAAGTGG + Intronic
929400095 2:41569759-41569781 CAGAGAAACTTCCAAGAAAAGGG + Intergenic
929642949 2:43600017-43600039 AACAAACAATTCCATCAAAAAGG + Intergenic
930207584 2:48603386-48603408 CATAAAATTTTCCATGAAAAAGG - Intronic
930451981 2:51552967-51552989 CACAAGTATTTCCATTAAAATGG - Intergenic
931591280 2:63886507-63886529 CACAATGATTTCCATGTCAATGG - Exonic
932860094 2:75282155-75282177 CAAAAAGACTGACATCAAAAAGG - Intergenic
933576710 2:84077667-84077689 TACATAGACTACAATGAAAATGG + Intergenic
935111738 2:100100492-100100514 AACAAAGGCTTCCATGAAATAGG - Intronic
935672572 2:105568364-105568386 CTCAAAGACTTCTCTGCAAATGG - Intergenic
936014247 2:108945571-108945593 CACAAAGAACACCAGGAAAAAGG + Intronic
936123227 2:109764676-109764698 AACAAAGGCTTCCATGAAATAGG + Intergenic
936221455 2:110606789-110606811 AAAAAAGGCTTCCATGAAATAGG - Intergenic
936815897 2:116460239-116460261 AACAAAGTCTGACATGAAAAAGG + Intergenic
937791091 2:125962619-125962641 CACAAAGACATAAATGCAAAAGG + Intergenic
940162549 2:150729108-150729130 CCCAAAGACTTCCCAGAATATGG - Intergenic
940716651 2:157233456-157233478 CACAAGGAATACCATGAGAAGGG - Intergenic
941021998 2:160417965-160417987 CACAAAGACATCCATCACAAAGG + Intronic
941455108 2:165706022-165706044 CACAAATAAATCTATGAAAAGGG - Intergenic
942735278 2:179103467-179103489 CACAAAGACTTACGTAAGAATGG + Exonic
943146407 2:184051288-184051310 CACAAGCACTCCCAGGAAAAGGG + Intergenic
943152869 2:184136657-184136679 CACAAAATCTACCAAGAAAATGG - Intergenic
943663179 2:190580612-190580634 CTTAAAGACTTCCATGGGAAAGG - Intergenic
943901517 2:193444288-193444310 AACAAAGACTTTCAGGAAGAAGG - Intergenic
944011194 2:194977453-194977475 CAAAAACACTTCTATCAAAAAGG + Intergenic
945272458 2:207955372-207955394 CCCAAAGTCTTTCAAGAAAATGG + Intronic
945666650 2:212752048-212752070 CTCAAAGTCATCCATGAAAGAGG - Intergenic
1169522592 20:6389565-6389587 CACAAAGACTGGCAGGAAACAGG - Intergenic
1169680845 20:8211440-8211462 AACAAACACTTCCATGTAAATGG - Intronic
1169914171 20:10671377-10671399 ATCAAAAACTGCCATGAAAAGGG - Intronic
1169937396 20:10898734-10898756 CACAAAGATGTCCATGAGAGGGG - Intergenic
1170231057 20:14047143-14047165 AACAAAGAAATCCATGGAAATGG + Intronic
1170775776 20:19373496-19373518 GACAAAAACATCCTTGAAAAAGG - Intronic
1171862517 20:30413650-30413672 GACAAAGACTTCTATGACTACGG - Intergenic
1173484934 20:43434146-43434168 CAGGAAGACTTCCCTGAAGAAGG + Intergenic
1173666137 20:44764466-44764488 CACAAATACTACAATAAAAATGG + Intronic
1173983579 20:47243650-47243672 AATAAAGACATCCATGTAAAAGG - Intronic
1177805095 21:25867588-25867610 AGCACAAACTTCCATGAAAATGG + Intergenic
1179199028 21:39197365-39197387 CAGAAAAATTTCCAGGAAAAGGG - Exonic
1181766663 22:25097320-25097342 AACAAAGACCCCCATAAAAATGG + Intronic
1183148286 22:36016026-36016048 CCCAACAACTTCCAGGAAAATGG + Intronic
1183756720 22:39773912-39773934 CACAAAAATTTCCAAGTAAAGGG + Intronic
1183962946 22:41423424-41423446 CACAAAGACTTGCATGCACTTGG + Intergenic
949327082 3:2878924-2878946 CACAAAGACTTGCAAGTAAATGG + Intronic
949692090 3:6652204-6652226 CTCAAATAATTCCATGAAATAGG - Intergenic
950702111 3:14757799-14757821 CACAAAGACTCCAAGGAGAAAGG - Intronic
955132710 3:56186951-56186973 GACAAGGACTTCCATGCAAGTGG + Intronic
957005374 3:74939576-74939598 CATAAAGGCTTCCAAGACAAAGG + Intergenic
959386280 3:105712422-105712444 CAGAAATATTTCCATAAAAATGG + Intronic
959772203 3:110111752-110111774 AATATAGACTTCCATGAAAACGG - Intergenic
960179910 3:114563767-114563789 CACAAAGACAGCCTAGAAAATGG + Intronic
960538932 3:118843629-118843651 CAAGATGAATTCCATGAAAATGG - Intergenic
961071290 3:123929965-123929987 TACAAAGACTTCCATAAGAAGGG + Intronic
962971531 3:140406075-140406097 CACAAAGAATGCCATGAACCAGG + Intronic
963062937 3:141239908-141239930 CACAAGGACTGGCATGAAACAGG + Intronic
963566001 3:146932023-146932045 CACAAGTAATTCCATGCAAAGGG + Intergenic
964821398 3:160774243-160774265 CTCACAGACTTGCATGAAGAAGG - Intronic
965647940 3:170903640-170903662 CACAAGGATTCCCATGAAACAGG + Intronic
966564273 3:181358924-181358946 CACAAACACTCCCAGGATAAAGG - Intergenic
966987883 3:185198754-185198776 CACAAAGAATTGCTTGAAACTGG + Intronic
968265751 3:197361851-197361873 CAAAAAGAGGTACATGAAAATGG + Intergenic
968951691 4:3698369-3698391 TACAAAGCCTACCATGAAAACGG - Intergenic
971598144 4:28558171-28558193 CACAAAGACTGCCAGAAAGATGG - Intergenic
971977121 4:33704724-33704746 CACAAAGTCTTCCAAGAATTTGG - Intergenic
974576568 4:63731487-63731509 CACAAAAACTTGTATGCAAAAGG + Intergenic
975376847 4:73656334-73656356 CACAAAGACTAGGATGAAAATGG + Intergenic
976588101 4:86821331-86821353 CAGAAAGAACTCCCTGAAAAGGG + Intergenic
979286892 4:118936484-118936506 GAGAAAGAATTCCATCAAAATGG + Intronic
980389420 4:132123875-132123897 CACAAGGACGCCCATGAAAATGG + Intergenic
981554617 4:145979258-145979280 CTCAAATCCTTCCAGGAAAAGGG - Intergenic
982166910 4:152621651-152621673 CATGAAGACTTCCTTGAATAAGG - Exonic
982264199 4:153523263-153523285 CACAAATACTTCCACTTAAAAGG - Intronic
982706994 4:158721334-158721356 TACACATACTTCGATGAAAAGGG + Exonic
982759799 4:159267745-159267767 CACACAGACTCCCCTCAAAAAGG - Exonic
983050500 4:163040552-163040574 CAAAAAGTATTCCATGAAAATGG + Intergenic
984845758 4:184106665-184106687 CACAGAGAGTGCCATGAAAGAGG - Intronic
985081304 4:186267049-186267071 CACTAAGACTTACAAGAAATAGG - Intronic
986435774 5:7728874-7728896 CAAAAAGACTTCCAGGAACCAGG + Intronic
988321681 5:29705715-29705737 AACAAGGACTTCCATCAAGAAGG - Intergenic
989583220 5:43052889-43052911 AACAAAGTTTTCCATGACAAGGG - Intergenic
989949114 5:50275773-50275795 AACAAACCCCTCCATGAAAAAGG - Intergenic
990504148 5:56427915-56427937 CAGAAAGGCTTCCAAGAAGAAGG - Intergenic
994820360 5:104642584-104642606 CACAAATATTTCCAGGAAATTGG - Intergenic
995519028 5:112983088-112983110 CACACAGACTGCCATGCCAAGGG + Intronic
995752486 5:115468346-115468368 AACAAATAGTTCCATGAAACAGG + Intergenic
996035023 5:118749346-118749368 CAAAAAGACTACCATGAGAGAGG + Intergenic
996340171 5:122428926-122428948 TATTAAGACTTCCATAAAAAAGG - Intronic
996375241 5:122798738-122798760 AAGAAAGAATTCCATGATAATGG - Intronic
996510384 5:124309460-124309482 CACACAGACACACATGAAAACGG + Intergenic
997159871 5:131596183-131596205 GAAAAAGACATCCATGCAAATGG + Intronic
997254071 5:132413743-132413765 CACATACACATCCATTAAAATGG + Intronic
998201634 5:140129145-140129167 CAAAAAACCTTCCATGAGAATGG - Exonic
999592620 5:153165461-153165483 CACAAAAAAATCCATGGAAATGG + Intergenic
999672467 5:153969615-153969637 CAAAGAAACTTTCATGAAAAAGG + Intergenic
1000958255 5:167568276-167568298 AACAAATCCTTCCATGCAAAAGG + Intronic
1001152579 5:169245148-169245170 CAAAAATACTTCATTGAAAAGGG + Intronic
1001287236 5:170432712-170432734 CACAAAGACTACCTTGAACCGGG + Intronic
1002858131 6:1056091-1056113 GCCAAAGACTTCCATGAAGTGGG - Intergenic
1002984137 6:2171770-2171792 CACAAAGACTTCCATGAAAAAGG + Intronic
1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG + Intronic
1004307464 6:14514062-14514084 GAAAAAGCCTTCCATGAAAGGGG + Intergenic
1006209544 6:32383895-32383917 AGCAAAGACTTCCAGGAAAAGGG - Intergenic
1006532061 6:34664311-34664333 AATAAAGACTGCAATGAAAATGG + Intronic
1008148635 6:47922658-47922680 CACAAAGAGTTCATTGAACAAGG - Intronic
1009467370 6:63988530-63988552 CACACAGATTACCATTAAAATGG + Intronic
1010734636 6:79429839-79429861 CAGGAAGACTTCAATTAAAATGG + Intergenic
1012030918 6:94061444-94061466 CACTGAGACTTTCATGAGAATGG + Intergenic
1013415212 6:109918585-109918607 CACAAAGAATTACAAGACAAAGG - Intergenic
1013849564 6:114497520-114497542 CTCAAAGGTTTCCATTAAAAAGG + Intergenic
1014086009 6:117344853-117344875 CACAGAGACTACAATGGAAATGG + Intronic
1015392994 6:132703861-132703883 AGCAAAGATTTCCATGCAAATGG + Intronic
1015602633 6:134925502-134925524 CAAAAAGAATTCAAGGAAAATGG + Intronic
1015755921 6:136606366-136606388 CAAAAAGAATACAATGAAAAAGG + Intronic
1015916855 6:138226454-138226476 GGCAAAGCTTTCCATGAAAAGGG - Intronic
1017007662 6:150039329-150039351 CAAAAAGACTTCCATTTAGAAGG - Intergenic
1017359997 6:153557076-153557098 CACAAAGTCATCCAGGCAAAAGG + Intergenic
1017587168 6:155939335-155939357 ACCAAAGACTTCCATTTAAAGGG - Intergenic
1018165391 6:161089507-161089529 CACACTGACTTTCATCAAAAAGG - Intronic
1018218001 6:161549686-161549708 CACAAAGAAGACCTTGAAAATGG - Intronic
1021024007 7:15642280-15642302 AACAAAGACTTCCAGAAATATGG - Intronic
1021287481 7:18798688-18798710 AACAAATACTTCTAAGAAAAAGG - Intronic
1022414192 7:30164128-30164150 CACAAAGAACTCTATGACAATGG - Intergenic
1023296652 7:38721834-38721856 CACAAAGACTCCCATGGGACTGG + Intergenic
1023664580 7:42509606-42509628 CACAAACACCTCAATTAAAAGGG + Intergenic
1025027826 7:55532700-55532722 CATGAAAACTTCCATGGAAAGGG - Intronic
1028596602 7:92552574-92552596 TTCAAAGTCTTTCATGAAAATGG + Intergenic
1029354284 7:100039653-100039675 CACACAGTCTTCCATGAGGATGG - Exonic
1029463970 7:100713710-100713732 CAAATATACTTCCCTGAAAAGGG - Intergenic
1029901257 7:104042355-104042377 CACAAACTCTTCCAAGAAATAGG - Intergenic
1030229288 7:107189208-107189230 CACAAAGTCTTACATGTAATGGG + Intronic
1030565928 7:111155611-111155633 CACATAAATTTCCATGAAAATGG + Intronic
1031153658 7:118083959-118083981 CATAAAGATTTATATGAAAAAGG + Intergenic
1031261316 7:119524800-119524822 CACAAACACTTTGATGGAAATGG + Intergenic
1031594733 7:123636814-123636836 CACAAATGCTTCAATGAACAAGG - Exonic
1032728971 7:134618680-134618702 TGCAAACACTTCCATGGAAATGG - Intergenic
1033284861 7:140032558-140032580 AACACAAACATCCATGAAAAGGG + Intronic
1033340907 7:140491529-140491551 CACAAAGGTTTCCAAGAAGATGG - Intergenic
1033615221 7:143007809-143007831 CAGAATGATTTCCATGAATAGGG - Intergenic
1033802615 7:144918897-144918919 TACAAAGAATATCATGAAAATGG + Intergenic
1034119538 7:148614722-148614744 CACATAAAGTTCCATGAAATTGG + Intronic
1036214821 8:6870473-6870495 CACAAAGCCTGCCTGGAAAAGGG - Intergenic
1038144349 8:24880758-24880780 CACAGAAACTTCTATAAAAATGG - Intergenic
1041291041 8:56308738-56308760 CAGATAGACTTACATGAAATTGG - Intronic
1041388472 8:57328701-57328723 CACAGAGACTTCCAAGAAAATGG + Intergenic
1042207198 8:66341362-66341384 CACAGATACTTGCATGAAAAGGG - Intergenic
1043520008 8:81034861-81034883 CACAAAGGCTGCCAGGAGAAGGG + Intronic
1044275057 8:90289549-90289571 CACAAAGACAGCTATGAAACAGG - Intergenic
1044445939 8:92275854-92275876 CCCAAACTCTTCCTTGAAAAGGG - Intergenic
1044546013 8:93460272-93460294 CACAAACACTACTATGTAAAAGG + Intergenic
1045184125 8:99818804-99818826 CACAAATTATTCCAGGAAAAGGG + Exonic
1045612357 8:103860369-103860391 CACAAACAACTCCATGAAGAAGG - Intronic
1046365714 8:113228515-113228537 CTCACAGAATGCCATGAAAAGGG + Intronic
1046604816 8:116359679-116359701 CCCAAAGATTTCCATGAAGCAGG + Intergenic
1047783887 8:128134785-128134807 CAGAAAGACATCCATGGAGATGG - Intergenic
1048064967 8:130958091-130958113 CCCAAAGACATCCAGGAGAATGG - Intronic
1048768931 8:137874313-137874335 CTCAAAGACAGCCATGCAAAGGG - Intergenic
1051036876 9:12757967-12757989 CACAAAAATTTCTAAGAAAAAGG + Intergenic
1051308301 9:15740323-15740345 CAAAAAAACTTCAATGATAAAGG - Intronic
1051516426 9:17935207-17935229 ATCAAAGACTTCCAGGAAGAGGG - Intergenic
1052209523 9:25886712-25886734 TAAAAAGACTTCCATGAACCGGG + Intergenic
1052214003 9:25943181-25943203 CACAAACTCTTTCATGAAATAGG + Intergenic
1052656550 9:31369973-31369995 TAAAACCACTTCCATGAAAAGGG - Intergenic
1055599429 9:77900411-77900433 CCCACAGTTTTCCATGAAAATGG - Intronic
1055607717 9:77988305-77988327 CAGAAAGAATACCAGGAAAACGG + Intronic
1056217516 9:84419015-84419037 CACAAAGACTTCCTTGAAGGAGG + Intergenic
1057024090 9:91722819-91722841 CCAAAATACTTCAATGAAAATGG + Exonic
1058589694 9:106549654-106549676 CACATACAGTTACATGAAAATGG + Intergenic
1058669471 9:107348292-107348314 CACAAGTCCTTCCATGAAGAGGG + Intergenic
1058813367 9:108662112-108662134 CACAAGGTCTTCCACGCAAAGGG + Intergenic
1059466163 9:114470173-114470195 GACAAAGATTTGCCTGAAAAAGG - Intronic
1060645303 9:125273881-125273903 CACAGAGGTTTCCAAGAAAATGG + Intronic
1062112740 9:134790932-134790954 CACACAGTCCTCCATGGAAAGGG - Intronic
1185847310 X:3449949-3449971 TACCAAGACTACCAGGAAAAGGG - Intergenic
1186247196 X:7626720-7626742 CACGTAGACTACCATGAACAGGG + Intergenic
1187201564 X:17138822-17138844 CACAAACACTTCAGTGAAAAAGG - Intronic
1188684201 X:33049210-33049232 TACAGAAACTTCCCTGAAAATGG + Intronic
1190925399 X:54899219-54899241 CACATGGACGCCCATGAAAAAGG + Intergenic
1193356800 X:80528887-80528909 GCAAAAGACTTGCATGAAAAAGG - Intergenic
1193651196 X:84135433-84135455 CAGAAAGATTTACATTAAAATGG - Intronic
1194131871 X:90091324-90091346 CCAAAAGAGTTCCATGATAATGG + Intergenic
1194640256 X:96395439-96395461 CACAGAGACTGCCAAGACAAAGG + Intergenic
1194641074 X:96404900-96404922 GGCAAAGACTTCCAATAAAAGGG - Intergenic
1195532897 X:105977593-105977615 ATCAAAGACTTCAATGTAAAAGG - Intergenic
1195616449 X:106916305-106916327 CACAAAGAGTTCCAGGCAGAAGG + Intronic
1195675613 X:107505216-107505238 CACAAATACTCCCATGAAGTAGG + Intergenic
1197440257 X:126478975-126478997 CATAAAAAATTCCATGCAAATGG + Intergenic
1197903289 X:131396078-131396100 CACAAAGAATTTCATAAGAAGGG + Intronic
1200735008 Y:6784760-6784782 AAGTTAGACTTCCATGAAAAAGG + Intergenic
1200823316 Y:7612034-7612056 CTCAAAGACTTACAGTAAAATGG - Intergenic
1200967612 Y:9111716-9111738 AACAAGGATTTACATGAAAATGG - Intergenic
1201898320 Y:19018075-19018097 CACACACACATACATGAAAAAGG + Intergenic
1202236739 Y:22719061-22719083 CTCAAAGACTTACAGTAAAATGG + Intergenic
1202306428 Y:23477107-23477129 CTCAAAGACTTACAGTAAAATGG - Intergenic
1202564381 Y:26193482-26193504 CTCAAAGACTTACAGTAAAATGG + Intergenic