ID: 1002985127

View in Genome Browser
Species Human (GRCh38)
Location 6:2182541-2182563
Sequence TTGGAATTGCAAATAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002985127 Original CRISPR TTGGAATTGCAAATAAACAC TGG (reversed) Intronic
900728371 1:4234013-4234035 ATGCATTTGAAAATAAACACAGG + Intergenic
902683063 1:18057386-18057408 TAGGAACTGCAAATCATCACTGG + Intergenic
905276274 1:36820182-36820204 TTGCAATTGCAAAAAAAACCTGG + Intronic
906269733 1:44466877-44466899 TTGGAATGGCAAATGAGCACTGG + Intronic
906556221 1:46716763-46716785 ATGGAATTGCAGAGAAACATTGG - Intronic
907796542 1:57723932-57723954 TTGGAATTGAAAATAGTTACAGG - Intronic
908893129 1:68868185-68868207 TGGGAATGGCAAATGAACATTGG + Intergenic
909246405 1:73290799-73290821 TTGGAATTGTAAATGAGCATTGG + Intergenic
909735649 1:78957941-78957963 TTGGAATGGTAAATGAGCACTGG - Intronic
910068071 1:83177622-83177644 TTGGAATGGCAAATAAGTATTGG + Intergenic
910187641 1:84560727-84560749 TTGGAATGGTAAATGAACACTGG - Intronic
910231686 1:84994244-84994266 TTGGAATGGTAAATGAGCACTGG + Intronic
911391046 1:97243804-97243826 ATGTAATTACAAATAAATACAGG - Intronic
911441922 1:97937835-97937857 CTGGGATTGCAAATAAACACTGG - Intergenic
912180816 1:107217024-107217046 TTGGACTTTCAAAGAAAAACTGG - Intronic
912783136 1:112572269-112572291 TTGGAATGGTAAGTAAGCACTGG + Intronic
912954187 1:114141794-114141816 TTGGAATGGTAAATAAGCACTGG - Intronic
913082943 1:115406449-115406471 TTGGAATGGTAAATAAGCATTGG + Intergenic
913255578 1:116950320-116950342 TTGTAATTGCAAGTAATCAAAGG + Intronic
914709613 1:150200970-150200992 TTGGAATGGTAAATAAGCATTGG + Intergenic
918130639 1:181625211-181625233 TTGGAATGGCCAATGAACATTGG + Intronic
920160774 1:203996309-203996331 TTGAATGTGCAAATAAACAGAGG + Intergenic
920452365 1:206069159-206069181 TAGGAATTGCAAATATTCACTGG - Intronic
922588706 1:226755995-226756017 TTGGAATGGTAAATGAGCACTGG - Intergenic
922622598 1:227001521-227001543 GTGGAATTGCAGATAAAGATAGG - Intronic
923441358 1:234023641-234023663 TTGGAATTGTAACTTAACAGTGG + Intronic
924689565 1:246333079-246333101 TAGGAATGGTAAATGAACACTGG - Intronic
1063247108 10:4232928-4232950 TTGGAATGGAAAATGAGCACTGG - Intergenic
1063677142 10:8150908-8150930 TTTGAATTTCAGATAAACAAGGG - Intergenic
1063722088 10:8594429-8594451 TTGGTTTTGCAATTAAAAACAGG - Intergenic
1064301014 10:14122756-14122778 TGGGGATTGCAACTGAACACAGG + Intronic
1064487569 10:15811087-15811109 TTGATAATGCAAATGAACACGGG + Intronic
1065409013 10:25400809-25400831 TTGGATTTGGAAATGTACACAGG - Intronic
1065739811 10:28786895-28786917 GTGGAAATAAAAATAAACACAGG + Intergenic
1066386006 10:34941753-34941775 TTGGAAATGCAAATTAAGATGGG + Intergenic
1066531255 10:36342336-36342358 TTGGAATGGTAAATCAACACTGG - Intergenic
1067529008 10:47056929-47056951 ATGGAGTTGCAAATTAAAACAGG + Intergenic
1068153270 10:53162273-53162295 TTGGAATTACAATTCAACATGGG - Intergenic
1068471853 10:57475522-57475544 TGGGAATTTCAAAAAAAAACTGG + Intergenic
1068706813 10:60086079-60086101 TTGGAATTGCAGTTAAAAATCGG + Intronic
1068753002 10:60618175-60618197 TTGCAATGGAAAATAGACACTGG - Intronic
1070837403 10:79458370-79458392 TTTGAATTTCAGATAAACAACGG + Intergenic
1072168618 10:92838564-92838586 TTGGCAATGCAAATAAACCTTGG - Intronic
1073480701 10:103784579-103784601 TCCTAATTACAAATAAACACTGG + Intronic
1074327767 10:112469664-112469686 ATGGAATTCCAAACAAACATAGG - Intronic
1075186078 10:120258942-120258964 TTGAAATGGCAAATGAACAGTGG + Intergenic
1075269096 10:121033563-121033585 TTGGGATTGGCAATAAAAACAGG + Intergenic
1075565484 10:123500619-123500641 GTGGAATTGCAAATCAAGATGGG + Intergenic
1078364460 11:10694517-10694539 TTTGGATTTCAGATAAACACAGG + Intergenic
1079042338 11:17070477-17070499 CTTGAATTGCTGATAAACACCGG - Intergenic
1079222327 11:18574118-18574140 TTTGAAATGCAAATAATCCCAGG - Intronic
1079406737 11:20154338-20154360 TTAGGATTGCAAAGAAACATGGG + Intergenic
1079493164 11:21011895-21011917 TTGAACATGAAAATAAACACTGG - Intronic
1080062484 11:27971662-27971684 TTGGATTAGTGAATAAACACTGG - Intergenic
1080117491 11:28637102-28637124 TGTGAATTTCAAATAAACAACGG + Intergenic
1080888485 11:36388175-36388197 ATGGGCTAGCAAATAAACACTGG - Intronic
1080938361 11:36885814-36885836 TTGGAACTCCAAACACACACTGG - Intergenic
1081744504 11:45463419-45463441 TTGAATTTACAAATAAAGACAGG - Intergenic
1082686585 11:56245515-56245537 TTGGAATGGTAAATGATCACTGG + Intergenic
1082712937 11:56576750-56576772 TAGGGATTACAAATAAACACAGG + Intergenic
1086081902 11:82912120-82912142 TTGGAATGGCAAATGAGCACTGG + Intronic
1087064692 11:94016653-94016675 TTGGAATGGTAAATGAGCACTGG - Intergenic
1088564861 11:111159562-111159584 TTGGAATTGCAAAGAACCCAGGG - Intergenic
1090853564 11:130592330-130592352 TTTGAATTGCAGATAAACAACGG + Intergenic
1090894255 11:130955681-130955703 TTTGAATAGCAAATAAGCATGGG - Intergenic
1091530257 12:1347996-1348018 TTATAATTGAAAATGAACACAGG + Intronic
1091918869 12:4288660-4288682 TGGTGATGGCAAATAAACACAGG + Intronic
1092173506 12:6387993-6388015 TTGGAGTTGTAAACAGACACAGG - Intronic
1092322678 12:7495003-7495025 TTGAAATTGAAAAGAAACATTGG - Intronic
1092460877 12:8684921-8684943 GTGTAATTTGAAATAAACACAGG - Intronic
1092875110 12:12841182-12841204 TTGGAATTGTCAGTAAATACAGG - Intergenic
1093785885 12:23191760-23191782 TTTGAATTCCAGATAAACAATGG + Intergenic
1095975719 12:47939680-47939702 TTTGAATTTCAGATAAACAATGG - Intronic
1098453672 12:70648732-70648754 TGGCAATTGCAACTGAACACTGG - Intronic
1098936780 12:76489452-76489474 TTGGAATGGTAAATGAACATTGG - Intronic
1099162060 12:79254238-79254260 TTGGAATGGTAAATGAGCACTGG - Intronic
1099514410 12:83579254-83579276 TTAGATTTGCAGATAAAAACTGG + Intergenic
1100117384 12:91323942-91323964 TTGGAATGGCAAATTAGCATTGG + Intergenic
1100516232 12:95330572-95330594 TTGGAATGGTAAATGAGCACTGG + Intergenic
1100961983 12:99972889-99972911 TTGGAATGGTAAATAAGCATTGG - Intronic
1101020650 12:100550271-100550293 TTGGAATTGTTAATAAAAATAGG + Intronic
1101213926 12:102562193-102562215 TTTGAATTTCAAATAAACAATGG - Intergenic
1103019144 12:117519847-117519869 TTGGAGAAGCACATAAACACCGG + Intronic
1103471764 12:121187582-121187604 GTGAAATTACAAATAATCACTGG + Exonic
1103671701 12:122621923-122621945 TTGGAAGAGCATATGAACACGGG + Exonic
1105288664 13:19030426-19030448 TTGGAATGGTAAATGAGCACTGG + Intergenic
1105425450 13:20291091-20291113 TTGGAATGGCTAACATACACAGG - Intergenic
1105924427 13:24994501-24994523 TTGGAATTGCGAATAGAGAAAGG + Intergenic
1106932936 13:34686456-34686478 TTGGAATTGCATATAAGCACTGG - Intergenic
1107623986 13:42263332-42263354 CTGAAATTGCATATAAACTCCGG - Intergenic
1107717807 13:43217745-43217767 AGGGAATTGGAAAGAAACACAGG + Intronic
1109283195 13:60380602-60380624 TTTTAATTGCAAATATTCACTGG - Intergenic
1109352250 13:61198621-61198643 CTGAAATGGCCAATAAACACAGG + Intergenic
1109401156 13:61830396-61830418 TTTGAATTCCAAATAAATAGCGG - Intergenic
1109467832 13:62761810-62761832 TTGGTAGATCAAATAAACACAGG + Intergenic
1109619485 13:64882832-64882854 TTTGAATGGCAAATAAAGCCCGG + Intergenic
1110746359 13:79057976-79057998 CTGGAATGGCAAATAAGCATTGG - Intergenic
1110752740 13:79134191-79134213 TCGGAATACCAAATAAACAGGGG + Intergenic
1113304370 13:109060753-109060775 TTGGAATTGCAAATGATAATTGG + Intronic
1114585516 14:23809537-23809559 TTGGAATTGTAAATGAGCATTGG - Intergenic
1115028773 14:28769968-28769990 ATGGATTTGGAAATAAACACAGG - Exonic
1115557378 14:34554185-34554207 TTGAAAAAGCAAACAAACACAGG + Intergenic
1115568419 14:34645055-34645077 TTGGAATGGTAAATGAGCACTGG + Intergenic
1116016482 14:39413941-39413963 TTGGAATGGCAAATGAGCACTGG + Intronic
1116370942 14:44131113-44131135 TTCAAATTGCAAATAAATATTGG - Intergenic
1116535463 14:46023045-46023067 TTGGAATTGTAAATAAAATTAGG + Intergenic
1116597716 14:46872759-46872781 TTAGAATTGCACATAAAGAATGG + Intronic
1116657294 14:47668540-47668562 TTGGATTTGAAAATAAAGATAGG + Intronic
1117054170 14:51893938-51893960 TTGGAATAGAAAATAAATCCAGG - Intronic
1117401393 14:55361467-55361489 TTGGAATGGTAAATGAACACTGG + Intronic
1117726174 14:58676654-58676676 TTGGAGTTGCATATAAATCCTGG + Intergenic
1117764436 14:59066061-59066083 TCAGAATGGCAAATAAACATTGG + Intergenic
1117857854 14:60054280-60054302 TTGTTATTTTAAATAAACACAGG + Intronic
1117887081 14:60375857-60375879 TTGGAATGGTAAATGAACATTGG - Intergenic
1118507808 14:66433463-66433485 TTGGAATGGGAAATAAGCATTGG - Intergenic
1119057485 14:71437900-71437922 TTGAAATTTAAAATATACACAGG + Intronic
1120118867 14:80653657-80653679 TTGTAATGGAAAATAAGCACTGG - Intronic
1121384304 14:93503672-93503694 TTCAAATGGCAAATAAACATAGG - Intronic
1121921366 14:97884858-97884880 TTGGAATAGCAAAGGACCACAGG + Intergenic
1123143258 14:106104277-106104299 GGGGAAAAGCAAATAAACACGGG - Intergenic
1124036608 15:26058772-26058794 TTGGAATAGCAAATGAACACTGG - Intergenic
1126307441 15:47276450-47276472 TTGGAATGGCAAATGAGCATTGG - Intronic
1127447064 15:59074208-59074230 CTGGAATTGCAAATGAGCATTGG + Intronic
1127886249 15:63203822-63203844 TTGGGATTGAAAAAAAACATGGG - Intronic
1128812727 15:70584470-70584492 GTGGAATTACAACTCAACACTGG + Intergenic
1129380131 15:75159671-75159693 TTGGAATTGAAAACAAATAGCGG + Intergenic
1129553387 15:76477758-76477780 TAGACATGGCAAATAAACACGGG - Intronic
1135604868 16:23814853-23814875 TTGTAATTGAAAAAAAAAACTGG - Intergenic
1135614791 16:23901838-23901860 CTGGGTTTGCAAATACACACTGG + Intronic
1137804765 16:51294473-51294495 TTGGAATGGCAAATGAGCATTGG + Intergenic
1138912306 16:61416147-61416169 TTGGAATTGGAAAGAGACCCAGG + Intergenic
1138983820 16:62302605-62302627 CTGGAAGTACAAATAATCACAGG - Intergenic
1139266473 16:65644191-65644213 TTTGAATTTCAGATAAACAAAGG - Intergenic
1140747603 16:77994872-77994894 TTGGAATTTCACACAAACAATGG + Intergenic
1144101951 17:11949255-11949277 TTGGCATTGCAATGAAACTCTGG - Intronic
1144324531 17:14166308-14166330 TTGGAATGGTAAATGAGCACTGG - Intronic
1145377588 17:22365513-22365535 ATGGAATGGCAAATAAGCATTGG + Intergenic
1146119426 17:30177923-30177945 TAGGAAATACAAATAAACTCTGG - Intronic
1146817546 17:35955183-35955205 TTGGAGTGGTAAATGAACACTGG + Intergenic
1148982038 17:51585443-51585465 TTGCAGTTCCAAATGAACACTGG - Intergenic
1149377310 17:56058121-56058143 TTGGAATGGTAAATGAACAATGG + Intergenic
1150198926 17:63332808-63332830 TTGGAATGGTAAATGAACATTGG - Intronic
1150662572 17:67096302-67096324 TTGGAATGGTAAACAAGCACTGG + Intronic
1151496137 17:74459403-74459425 TTGGTATTTTAAATAAAGACAGG + Intergenic
1151779897 17:76239214-76239236 TTGCAATTAAAAGTAAACACCGG + Intronic
1151962792 17:77416046-77416068 TTGGAATTTTAAATTAAGACAGG + Intronic
1153133112 18:1880611-1880633 TTAGAATGGTAAATAAGCACTGG + Intergenic
1153361500 18:4202916-4202938 TAGGAAGTACAGATAAACACAGG + Intronic
1153410720 18:4789537-4789559 TTGCACTTGCACATACACACTGG - Intergenic
1153545924 18:6204626-6204648 TTGGAAATGCAAATAAAACAAGG + Intronic
1154223986 18:12484313-12484335 TTGGTCTGGAAAATAAACACAGG - Intronic
1154471070 18:14702214-14702236 TTGGAATGGTAAATGAGCACTGG - Intergenic
1155681454 18:28491715-28491737 TTGCAATTGTAAATGAACACTGG - Intergenic
1155833793 18:30552613-30552635 TTGGAATTCCAAATCACCAGAGG - Intergenic
1155853763 18:30806043-30806065 TTGGAATGGCAAATGAGCATTGG - Intergenic
1156110702 18:33722876-33722898 TTGGAATGGCAAATGAGCACTGG - Intronic
1156802975 18:41140662-41140684 TTTGCTTTGCAAATAAACAAGGG + Intergenic
1158757374 18:60342393-60342415 TTGGAATTGTAAACAAGCATTGG - Intergenic
1160199387 18:76783584-76783606 TTGTAATTCCAAATAAAATCTGG - Intergenic
1161439391 19:4281940-4281962 TTGGTATTACAAATCAACACAGG + Intronic
1162252377 19:9456485-9456507 TTGGCAGTACAAATAAACAAGGG + Intergenic
1163361499 19:16849545-16849567 AGGGAATGGCAAATTAACACAGG - Intronic
1164404433 19:27930981-27931003 TTGGAATAGCAAATAACTCCAGG + Intergenic
1165787740 19:38472408-38472430 GTGGAATTGTAACTGAACACAGG + Intronic
1165819898 19:38668038-38668060 TTAGAATTACAAATAAACCCTGG + Intronic
925590803 2:5507617-5507639 CTGGAAAAGCAAACAAACACAGG - Intergenic
925954336 2:8947574-8947596 TTGGAATGGTAAATGAACATTGG - Intronic
926910644 2:17849679-17849701 TTTGAATTCCAGATAAACAATGG - Intergenic
927647608 2:24887787-24887809 TGCGAAATGCAAATAACCACAGG + Intronic
928792001 2:34968636-34968658 TGGGAATGACAAATAAGCACTGG + Intergenic
929529699 2:42740837-42740859 TTGGAATAGTAAATGAACACTGG + Intronic
930504900 2:52271075-52271097 TCAGAATGGCAAATAAGCACTGG + Intergenic
931179412 2:59884553-59884575 TTGGAATAGAAAATCAGCACTGG - Intergenic
931188999 2:59981392-59981414 TTTGAATTTCAGATAAACAATGG + Intergenic
932109197 2:68979411-68979433 TTTGAATTTCAGATAAACAATGG - Intronic
932172732 2:69572274-69572296 TTAGAATTTAAAATAAAGACAGG - Intronic
932871243 2:75400801-75400823 TTAGAATTAAAAATAAACACTGG - Intergenic
933350101 2:81143321-81143343 TTGGAATAGTAAATAAGCATTGG - Intergenic
933906321 2:86897283-86897305 TTGGAATGGTAAATGAGCACTGG - Intergenic
933914805 2:86979051-86979073 TTGGAATTGGAAATAAAAGTAGG + Intronic
934008189 2:87790849-87790871 TTGGAATTGGAAATAAAAGTAGG - Intronic
934092419 2:88564157-88564179 TTGTAATTACGAAGAAACACAGG - Intronic
934782977 2:96984633-96984655 TTGGAATGCCATATAATCACTGG - Intronic
935771826 2:106431789-106431811 TTGGAATTGGAAATAAAAGTAGG - Intronic
935908245 2:107864152-107864174 TTGGAATTGGAAATAAAAGTAGG + Intronic
935974357 2:108562944-108562966 TTGGAATAGTAAATGAGCACTGG - Intronic
935994652 2:108756383-108756405 TTGGAATTGGAAATAAAAGTAGG + Intronic
936079925 2:109425533-109425555 TCGGAATGGCAAATGAACACTGG - Intronic
936130034 2:109829274-109829296 TTGGAATTGGAAATAAAAGTAGG + Intronic
936214663 2:110542211-110542233 TTGGAATTGGAAATAAAAGTAGG - Intronic
936365849 2:111854399-111854421 TTGGAATGGTAAATGAGCACGGG + Intronic
936423800 2:112396774-112396796 TTGGAATTGGAAATAAAAGTAGG - Intronic
936798206 2:116233028-116233050 TCAGAATAGCAAATGAACACTGG - Intergenic
938424054 2:131169462-131169484 TTGGAATGGCAAATGAACATTGG - Intronic
939516970 2:143181298-143181320 TTGGAAGGGCAAATGAGCACTGG + Intronic
939556133 2:143675791-143675813 TTGGAATGGTAAATGAGCACTGG + Intronic
940280810 2:151987829-151987851 TTGGAAATGGAAATATACAAAGG - Intronic
940502606 2:154512630-154512652 TTGGAATTTAGAATACACACAGG - Intergenic
940556801 2:155239119-155239141 TTGAAATTGAAAATGGACACAGG + Intergenic
941000039 2:160192857-160192879 TAAGAATGGCAAATAAACACAGG + Intronic
941238314 2:163003733-163003755 TTGGAATGGTAAATGAGCACTGG - Intergenic
941419136 2:165260546-165260568 TTGGAATGGTAAATGAGCACTGG + Intronic
941519635 2:166524075-166524097 TAGGAAATGTAAATAAACATTGG - Intergenic
941617302 2:167735280-167735302 TTGGACTTGCCAATAAATTCTGG + Intergenic
941974673 2:171390056-171390078 TGGGAATAGTAAATAAGCACTGG - Intronic
942609814 2:177731702-177731724 TTGGAAGTGCAAATGAAGATGGG - Intronic
943714097 2:191131285-191131307 TTGCAATAGCAAAGAAATACAGG + Intronic
943968354 2:194367961-194367983 TGAAAATTGCAAATAAACAAGGG + Intergenic
944161060 2:196660529-196660551 TAGGGATTGCAAATCAAAACAGG - Intronic
944315322 2:198278826-198278848 TTGGAATTCCAAGTAAATACAGG + Intronic
945330453 2:208533727-208533749 TTGGAATAGCAAATGTCCACTGG - Intronic
945666557 2:212751239-212751261 TTGGAATGGTAAATGAGCACTGG - Intergenic
1169663132 20:8002672-8002694 TTTGAATTGCAAGTTACCACAGG - Intronic
1169756680 20:9050300-9050322 TTGAAATGGTAAATAAACATTGG + Intergenic
1170295646 20:14821858-14821880 TTGGAAATGTAAGTATACACTGG - Intronic
1170655656 20:18285705-18285727 TTGAACTTGAAAATAAAGACAGG - Intergenic
1171573012 20:26271577-26271599 ATGGAATGGCAAATAAGCATTGG + Intergenic
1172236198 20:33376984-33377006 TCAGAATGGCAAATCAACACTGG + Intronic
1173765247 20:45601398-45601420 CAGGCATTGCAAATAAACCCAGG - Intergenic
1174650619 20:52121887-52121909 TTGGAATGGTAAATGAGCACTGG - Intronic
1174652627 20:52140928-52140950 TTGGAATGGTAAATGAGCACTGG - Intronic
1175243488 20:57567062-57567084 CTGGAATATCCAATAAACACTGG - Exonic
1176803416 21:13455719-13455741 TTGGAATGGTAAATGAGCACTGG + Intergenic
1177326219 21:19592564-19592586 TTTGAATTTCAAGTAAACAATGG + Intergenic
1177331443 21:19669336-19669358 TTGGAATGGTAAATGAGCACTGG + Intergenic
1177439555 21:21103317-21103339 GTGGAACTGCAATTAAACTCAGG + Intronic
1177719790 21:24891259-24891281 TTTGAATTTCAAATGAACAATGG + Intergenic
1178175378 21:30091387-30091409 TTTGAATTTTAAATAAACCCAGG + Intergenic
1179178715 21:39027265-39027287 TTTGAATTGCAGATCAACAGTGG + Intergenic
1180113394 21:45677712-45677734 TTGGAATGGTAAATGAGCACTGG - Intronic
1180932513 22:19602447-19602469 CTGGAATGGCGAATAAACATTGG + Intergenic
1181983161 22:26780783-26780805 TTGGAATTTGAAAAAAATACTGG - Intergenic
1182878902 22:33716289-33716311 TTGGAATTTCACATAAACAATGG - Intronic
1183283365 22:36946143-36946165 TTGGAATTGTAAATGAGCATTGG + Intergenic
949094800 3:73513-73535 TTTGAATTGCAAATGAAACCTGG - Intergenic
949203164 3:1405518-1405540 TTGGATTTTGACATAAACACAGG - Intergenic
949215704 3:1564659-1564681 TTGGAATTGCCAATTAACTTGGG - Intergenic
950445176 3:13033052-13033074 TTGAATTTTAAAATAAACACAGG - Intronic
950562175 3:13738174-13738196 TTGGAATGGTAAGTGAACACTGG - Intergenic
951062016 3:18220031-18220053 TTGGAATTTTAAATAAAGACAGG + Intronic
951449803 3:22824585-22824607 TTGGAATAGAAAATAAACTGGGG - Intergenic
951947182 3:28152063-28152085 TGGAAATTGCTAATGAACACAGG + Intergenic
952030687 3:29138938-29138960 TTGGAATTTGAAATAACTACAGG - Intergenic
952525337 3:34204203-34204225 GTGGAAGTGAAAATAAACCCAGG + Intergenic
952774868 3:37035561-37035583 TTGGAATGGCAAATGAGCATGGG - Intronic
952774965 3:37036563-37036585 TTGGAATAGCAAATGAGCACTGG - Intronic
954373035 3:50179157-50179179 TTGGAATGGTAAATGAGCACTGG + Intronic
956533648 3:70251120-70251142 ATGGAATTACAATTAACCACAGG - Intergenic
957099225 3:75807704-75807726 TTGGAAGCACAAATAAACAAGGG - Intergenic
957831827 3:85531584-85531606 AGAGAGTTGCAAATAAACACAGG - Intronic
958032607 3:88130922-88130944 TTGGAATTTCAAATAGAGAAAGG + Intronic
958530030 3:95316256-95316278 TTGAAATGGCAAATAAGCATTGG + Intergenic
958578306 3:95982319-95982341 TTGAAAGTTCAAATAATCACTGG - Intergenic
959357392 3:105349876-105349898 TGGGAATTCCAAATAATCATGGG + Intergenic
959413134 3:106049908-106049930 TTGGAATGGTAAATAAGCATTGG - Intergenic
959643126 3:108664189-108664211 CTGGAATTGCTAATAAGCACAGG + Intronic
959800015 3:110482202-110482224 TTAGAATTGTAAATAAGCATTGG - Intergenic
959821067 3:110736237-110736259 TAGGAATGGTAAATGAACACTGG + Intergenic
960599493 3:119441870-119441892 TTGGAATGGTAAATAAGCATTGG - Intronic
963243088 3:143030308-143030330 TTGGAATGGTAAATGAGCACTGG - Intronic
963481727 3:145883654-145883676 TTTGAATTTCAGATAAACAATGG + Intergenic
964599183 3:158476495-158476517 TTGGAATGGGAAATGAGCACTGG - Intronic
964823399 3:160798435-160798457 TTGAAATGGCAAATAAGCATTGG - Intronic
965141547 3:164842644-164842666 TTGGAATGGTAAATAAACGTTGG - Intergenic
965424460 3:168504504-168504526 GTGGAATGGCAAATGAGCACTGG + Intergenic
965438741 3:168686477-168686499 TTGGAATGGTAAATAAGCATTGG - Intergenic
966214269 3:177485641-177485663 TTGGAATTGTAAATGAGCATTGG + Intergenic
966282507 3:178249017-178249039 TTGGAATAGCAAATCAACATTGG + Intergenic
966995766 3:185278587-185278609 TCAGAATGGCAAATAAGCACTGG + Intronic
968318685 3:197746654-197746676 TTTGAATTTCAGATAAACAACGG - Intronic
968508813 4:986161-986183 TTGGAATTGCAGGCCAACACGGG - Intronic
968776953 4:2548010-2548032 CAGGAATGGCAAATAAACACAGG - Intronic
968964155 4:3761134-3761156 ATGAAATTTCAAATAAACATAGG + Intergenic
969292216 4:6247222-6247244 TTTGAATTTCACATAAACAACGG - Intergenic
970435025 4:16025112-16025134 TTGAGATTCCAAATATACACAGG + Intronic
970578889 4:17455201-17455223 TTGGAATGGTAAATGAGCACTGG - Intergenic
970846847 4:20550185-20550207 TTGGAAGTGCAAATTAAGACAGG - Intronic
971470540 4:27021307-27021329 TTGGGGTTGCAAACAAAGACAGG + Intronic
975686445 4:76920410-76920432 TTGGAATGGTAAATGAACATTGG + Intergenic
975880034 4:78894173-78894195 TTGGAATGGCAAGTAAGCATTGG + Intronic
975900325 4:79143878-79143900 TTGGAATGGTAAATGAGCACTGG + Intergenic
976481200 4:85547890-85547912 ATGGAATTACAAATTAACAATGG - Intronic
977265220 4:94845766-94845788 TTAGAATTTCAATTAAAAACTGG - Intronic
977451035 4:97198378-97198400 TTGGCATTGCAAATAAGCTGAGG + Intronic
977596998 4:98894222-98894244 TGGGAATGGCAAATGAGCACTGG + Intronic
978010221 4:103672674-103672696 TTGGAATAACAAATGAGCACTGG + Intronic
978085799 4:104651624-104651646 TTGTAATTGCATATAATTACAGG - Intergenic
979123642 4:116936961-116936983 TTGGAATGGTAAGTAAGCACTGG + Intergenic
979756294 4:124344091-124344113 TTGGAAATGGACATAAACAAAGG - Intergenic
980220135 4:129902987-129903009 CTGCTATTGCGAATAAACACAGG - Intergenic
980457578 4:133065618-133065640 TTGTAATTGTAACTAAATACTGG + Intergenic
980462023 4:133126406-133126428 TTGGGATTGTAAATAAATAGAGG - Intergenic
980645710 4:135639993-135640015 TTTGAATTTCAAATAAACAATGG - Intergenic
980963331 4:139497989-139498011 TTGGAAATAGAAATAAAAACTGG + Intronic
981034519 4:140155538-140155560 TTGGCATTGCAGATTAGCACAGG + Intergenic
981249582 4:142583588-142583610 ATGTAAATGCAAACAAACACTGG + Intronic
981487491 4:145302410-145302432 GTGGAGATGGAAATAAACACAGG - Intergenic
981493076 4:145361962-145361984 TTGAAATGGCAAATGAACATTGG - Intergenic
981574776 4:146193158-146193180 TTGAAATTCCAAATAAACTCAGG + Intronic
983058326 4:163125870-163125892 TTGGAATTGTAAATGAGCATTGG - Intronic
983073696 4:163299173-163299195 TTGGAATTGTAAATGAATAGTGG + Intergenic
983505183 4:168545741-168545763 TTGTCATTGTAAATAAATACTGG - Intronic
984446232 4:179839987-179840009 TTGGAAATGCTAATAGAAACAGG + Intergenic
984817803 4:183854312-183854334 TTATAATGTCAAATAAACACTGG - Intronic
985270559 4:188190668-188190690 TAGGAAGTGCAATTAAACACAGG - Intergenic
987695682 5:21327147-21327169 TTTTAGTTGCAGATAAACACAGG - Intergenic
987907730 5:24099565-24099587 TTTGAATTTCAGATAAACAATGG - Intronic
990481645 5:56217083-56217105 TTGGAATGGTAAATGAGCACTGG - Intronic
990697011 5:58429806-58429828 TTAAAATTACAAATAAAGACAGG + Intergenic
990991581 5:61689608-61689630 GTGGATTTGCTTATAAACACAGG - Intronic
991168387 5:63591303-63591325 TTGGAAGGGGAAAAAAACACAGG + Intergenic
991744720 5:69724949-69724971 TTTTAGTTGCAGATAAACACAGG + Intergenic
991752984 5:69830284-69830306 TTTTAGTTGCAGATAAACACAGG - Intergenic
991796291 5:70304673-70304695 TTTTAGTTGCAGATAAACACAGG + Intergenic
991802603 5:70387011-70387033 TTTTAGTTGCAGATAAACACAGG - Intergenic
991824100 5:70600263-70600285 TTTTAGTTGCAGATAAACACAGG + Intergenic
991832303 5:70705403-70705425 TTTTAGTTGCAGATAAACACAGG - Intergenic
991888669 5:71304232-71304254 TTTTAGTTGCAGATAAACACAGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
993893218 5:93500302-93500324 TTGGAATAGCAAATGAGCATTGG - Intergenic
993897810 5:93558953-93558975 TTGGAATGGCAAATGAGCATTGG + Intergenic
994431244 5:99664079-99664101 TTCAAATTGCAAATGAGCACTGG + Intergenic
994466938 5:100147940-100147962 TTGGAATGGTAAACAAGCACTGG + Intergenic
997741022 5:136254400-136254422 TTGGAATGGTACATGAACACTGG - Intronic
998813543 5:145989895-145989917 TTAAAATTGGAAATAAACTCAGG + Intronic
998940426 5:147276063-147276085 TTGAATTTGCAAATAAATCCTGG + Intronic
999688068 5:154120297-154120319 TTGGAATGGTAAATAAGCATTGG - Intronic
1000312545 5:160059039-160059061 TTGGAATGGTAAATGAGCACTGG + Intronic
1000549800 5:162646931-162646953 TTGGAATGGTAAATAGGCACTGG + Intergenic
1002302877 5:178267463-178267485 TTGGAAATGGAAATAAAAATAGG - Intronic
1002985127 6:2182541-2182563 TTGGAATTGCAAATAAACACTGG - Intronic
1003365471 6:5470715-5470737 TTGGAATTTTTAATAAACACAGG - Intronic
1003473240 6:6457061-6457083 TTGGAATGGCAAACGAGCACTGG - Intergenic
1004880709 6:20004440-20004462 TGGAAAATGCAAATAAACCCAGG - Intergenic
1005212072 6:23477731-23477753 ATAAAATTGTAAATAAACACAGG + Intergenic
1005555102 6:26970921-26970943 TTTTAGTTGCAGATAAACACAGG + Intergenic
1006875770 6:37294584-37294606 TTGGAATGGTAAATGAGCACGGG - Intronic
1008721746 6:54362310-54362332 TTGGAATGGTAAATAAGCATTGG - Intronic
1009274970 6:61663996-61664018 TTGTAATTGAAAATCAAAACAGG + Intergenic
1009387335 6:63101203-63101225 TTGGAATGGTAAATGAACATTGG + Intergenic
1009509143 6:64525939-64525961 TTGTAATAGCAAAAAAATACTGG + Intronic
1009951084 6:70397055-70397077 TTGAAGTTGAAAATAAACAAAGG - Intergenic
1010050117 6:71493852-71493874 TTGGAATGGCAAATGAGCACTGG - Intergenic
1010693022 6:78933062-78933084 TTGGAATGGTAAAGAAGCACTGG + Intronic
1010724529 6:79318181-79318203 TTGGAATAGCAAATAAGAATTGG + Intergenic
1010729211 6:79370415-79370437 TTGGAATGGCAAATGAGCATTGG - Intergenic
1011045672 6:83079536-83079558 TTGGATTTTCAAATAAAGACTGG - Intronic
1011991564 6:93525823-93525845 TTTGATTTACAAATAAACTCTGG - Intergenic
1012010821 6:93782645-93782667 TTGGCATTGCACATACACATTGG - Intergenic
1012034893 6:94122617-94122639 TTTCAATTTCAAATAAACAATGG - Intergenic
1012271774 6:97221719-97221741 TTGGTTTTTCAAATAAAAACTGG + Intronic
1013030932 6:106332132-106332154 TCAGAATGGCAAATAAACATTGG - Intergenic
1013569550 6:111408080-111408102 ATGGAATTGGAAAGAAAGACGGG + Intronic
1014775105 6:125499767-125499789 TTGGAATAGTAAATGAGCACTGG + Intergenic
1015640780 6:135329359-135329381 TTGAAATGGCAAATGAACACTGG - Intronic
1017415765 6:154219097-154219119 CTGGAAATGTAAATAAACACTGG + Intronic
1020436080 7:8163893-8163915 CTGGAATAGCAGAAAAACACTGG + Intronic
1020621241 7:10522258-10522280 TTGGGGCTGCAAATAAAAACAGG + Intergenic
1021376511 7:19914379-19914401 TTGAAATGGCAAATTAACATTGG + Intergenic
1021703875 7:23347501-23347523 TGGGAATTGCCAACAAACAGAGG - Intronic
1023286878 7:38630237-38630259 TTGTACTTGAAAATCAACACCGG - Intronic
1023648782 7:42347019-42347041 TAGGTATTACAAATAAACTCTGG - Intergenic
1024336634 7:48214359-48214381 TTGGAATGGTAAATAAACACTGG + Intronic
1025286369 7:57665327-57665349 ATGGAATGGCAAATAAGCATTGG - Intergenic
1027223490 7:76229272-76229294 TTTGAATTTCAGATAAACAACGG + Intronic
1027276025 7:76557138-76557160 TTGGAATGGCAAATAAGTATTGG - Intergenic
1027560395 7:79721116-79721138 TTGGAATGACAAATAATCACAGG + Intergenic
1028009136 7:85618422-85618444 TTGGTATTGTATATAAAGACAGG + Intergenic
1028178249 7:87682772-87682794 TTGGAATGGTAAATAAGCATTGG + Intronic
1028202786 7:87981752-87981774 TTGGAATTGAAAGTTAACTCTGG + Intronic
1028865743 7:95709346-95709368 TTGGAAATGCCAATAGGCACAGG - Intergenic
1029061376 7:97801371-97801393 TTGGAATTGCACATAGGCAGAGG - Intergenic
1031026908 7:116689478-116689500 TTTGAATTTCAGATAAACAGTGG - Intronic
1033014312 7:137656384-137656406 TTGGAACTGGAAATTTACACCGG + Intronic
1033019684 7:137711211-137711233 TTGAAGGTGCACATAAACACAGG + Intronic
1036450968 8:8867179-8867201 TAGGAAATGGAATTAAACACAGG + Intronic
1036735655 8:11313093-11313115 TCAGAATTGCAAATAATCACTGG + Intronic
1037159126 8:15745803-15745825 AGGCAATTGCAAATAAAAACTGG - Intronic
1037905633 8:22714492-22714514 TTTGAATTCCAGATAAACAACGG - Intronic
1039337271 8:36605504-36605526 TTGAAATGGCAAATAAGCATTGG + Intergenic
1039556339 8:38478202-38478224 TTGAAATGGTAAATGAACACTGG - Intergenic
1040436435 8:47395829-47395851 TTGAAATTGCAAATACCAACAGG - Intronic
1042236393 8:66617210-66617232 TTGGGATTGAAAATAACCATCGG + Intergenic
1042356295 8:67831541-67831563 TTGCAATAGCAAATAAATAAGGG + Intergenic
1043090930 8:75902886-75902908 TTGGAATGGCAAGTGAGCACTGG - Intergenic
1043173079 8:76989839-76989861 TTAGAATGGTAAATAAGCACTGG + Intronic
1043237749 8:77890233-77890255 GTGGAATTGCAAAGAAACAGAGG - Intergenic
1043238316 8:77898402-77898424 TGGGAATAGTAAATAAGCACTGG + Intergenic
1045092310 8:98758570-98758592 TTGGAATGGGCAATGAACACTGG + Intronic
1045232873 8:100322054-100322076 GTGGAATGGTAAATGAACACTGG + Intronic
1045285925 8:100791329-100791351 TTCGAATTGCAGATAAGCAGTGG - Intergenic
1045966981 8:108036232-108036254 TTGGAATGGTAAATAAGCATTGG - Intronic
1046927614 8:119808951-119808973 TTGGAATGGTAAATGAGCACTGG + Intronic
1047049177 8:121091209-121091231 TTGGAATGGTAAATGAACACTGG + Intergenic
1047104463 8:121718256-121718278 ATGGAATAACAAAGAAACACAGG - Intergenic
1048433464 8:134392413-134392435 TTGGAATGGTAAATAAGCATTGG - Intergenic
1051077376 9:13255831-13255853 TTGAAATGGTAAATAAGCACTGG + Intronic
1051201472 9:14630973-14630995 TTGGAATGGCAAATGAGCACTGG + Intronic
1051291259 9:15547892-15547914 TTGGAATGGTAAATAAGCACTGG + Intergenic
1051731369 9:20146723-20146745 TTGGAATTGAAAATACAGAATGG - Intergenic
1052235979 9:26213995-26214017 TTGGAAATGCAAAAAAATATGGG + Intergenic
1054994563 9:71370901-71370923 TTAGAATGGCAAATAAGCACTGG - Intronic
1056859691 9:90168897-90168919 TTGGAATTGAAAATTTACACAGG + Intergenic
1057949016 9:99355017-99355039 TATGAATGGCAAATAAGCACAGG + Intergenic
1058197461 9:101995859-101995881 TCTGAATTTCAAATAAACAGTGG + Intergenic
1059049679 9:110910231-110910253 TTGGAATGGTAAATGAGCACTGG - Intronic
1059756292 9:117296780-117296802 TTGGAATCATAAAGAAACACAGG + Intronic
1060664606 9:125425273-125425295 TTTGAATTTCAGATAAACAATGG - Intergenic
1061784446 9:133018098-133018120 TTGGAATGGTAAATGAGCACTGG - Intergenic
1185719073 X:2367515-2367537 TGGGAATTGAAAATAAGAACAGG + Intronic
1187152935 X:16697809-16697831 TTGGAAGTGTAAAGAGACACTGG - Intronic
1188469266 X:30518806-30518828 TTAGAATGGTAAATAAACATTGG - Intergenic
1189014593 X:37083908-37083930 TTGGAATAGTAAATGAGCACTGG - Intergenic
1189239203 X:39512658-39512680 CTTGAATTGCAAATAATCCCAGG + Intergenic
1189252847 X:39614413-39614435 TTGAAATTGGGAGTAAACACAGG + Intergenic
1189690769 X:43614569-43614591 TTAGAATTGTAAATAAATTCAGG - Intergenic
1190486671 X:50933262-50933284 TTGGAATGGTAAATAAGCACTGG - Intergenic
1192388678 X:70701313-70701335 TTGGAATGGTAAATAAGCATTGG - Intronic
1193492197 X:82163523-82163545 CTGGAATCTCAAATAAATACCGG + Intergenic
1193652134 X:84149782-84149804 TTGGAATGGCAAATGAGCATTGG + Intronic
1193971315 X:88057614-88057636 TTGGAATAGCACATGAGCACTGG - Intergenic
1195122290 X:101767456-101767478 TTGGAATTTCAGATAAACAATGG - Intergenic
1195317717 X:103695017-103695039 TTGCATTTGCAAAAAAACTCCGG - Intergenic
1195394672 X:104398059-104398081 TTGGGATTGAGAATAAAGACTGG - Intergenic
1195632946 X:107078547-107078569 TTGGTATTGCAAAGGAATACAGG - Intronic
1196172154 X:112601033-112601055 TTTGAACTGGAACTAAACACTGG + Intergenic
1197249355 X:124198844-124198866 TTGGGCTTGCAAATATAAACTGG + Intronic
1198158959 X:133988008-133988030 TTGGAAATGGAAATAATTACTGG + Intergenic
1198363569 X:135918763-135918785 TTGAAATTTAAAATAAAGACAGG + Intergenic
1198405876 X:136311866-136311888 TTTAAATTGTAAATAGACACAGG + Intronic
1198502739 X:137268267-137268289 TTGGAATTTGAAATAAACAGTGG + Intergenic
1198840505 X:140852105-140852127 GTGGAGTTGGAGATAAACACTGG - Intergenic
1199369697 X:147033172-147033194 TTGGAATGGTAAATGAGCACTGG - Intergenic
1199815047 X:151389713-151389735 TTGGAATGGTAAATAAGCATTGG - Intergenic
1201384686 Y:13425848-13425870 TTAGTATTGCAAATAAACACTGG - Intronic
1201980312 Y:19900155-19900177 AAGCAATTGCAAATAAACCCAGG + Intergenic