ID: 1002985962

View in Genome Browser
Species Human (GRCh38)
Location 6:2191015-2191037
Sequence GAGGCAGCACTGGGGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002985952_1002985962 8 Left 1002985952 6:2190984-2191006 CCCACAACTGCTGCGGGGAGGGC 0: 1
1: 1
2: 3
3: 13
4: 114
Right 1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG No data
1002985945_1002985962 20 Left 1002985945 6:2190972-2190994 CCACCACTCTCACCCACAACTGC 0: 1
1: 0
2: 0
3: 49
4: 497
Right 1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG No data
1002985953_1002985962 7 Left 1002985953 6:2190985-2191007 CCACAACTGCTGCGGGGAGGGCA 0: 1
1: 2
2: 2
3: 15
4: 156
Right 1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG No data
1002985946_1002985962 17 Left 1002985946 6:2190975-2190997 CCACTCTCACCCACAACTGCTGC 0: 1
1: 1
2: 3
3: 44
4: 413
Right 1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG No data
1002985942_1002985962 27 Left 1002985942 6:2190965-2190987 CCCCACACCACCACTCTCACCCA 0: 1
1: 0
2: 10
3: 89
4: 1021
Right 1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG No data
1002985944_1002985962 25 Left 1002985944 6:2190967-2190989 CCACACCACCACTCTCACCCACA 0: 1
1: 0
2: 5
3: 192
4: 1527
Right 1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG No data
1002985943_1002985962 26 Left 1002985943 6:2190966-2190988 CCCACACCACCACTCTCACCCAC 0: 1
1: 0
2: 12
3: 95
4: 1099
Right 1002985962 6:2191015-2191037 GAGGCAGCACTGGGGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002985962 Original CRISPR GAGGCAGCACTGGGGGACCC AGG Intronic
No off target data available for this crispr