ID: 1002992955

View in Genome Browser
Species Human (GRCh38)
Location 6:2254890-2254912
Sequence GCCATCAGGCAGGATCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002992955_1002992966 9 Left 1002992955 6:2254890-2254912 CCATCCAGATCCTGCCTGATGGC No data
Right 1002992966 6:2254922-2254944 TTCTATGGGTAATTAGGACGGGG No data
1002992955_1002992965 8 Left 1002992955 6:2254890-2254912 CCATCCAGATCCTGCCTGATGGC No data
Right 1002992965 6:2254921-2254943 GTTCTATGGGTAATTAGGACGGG No data
1002992955_1002992960 -5 Left 1002992955 6:2254890-2254912 CCATCCAGATCCTGCCTGATGGC No data
Right 1002992960 6:2254908-2254930 ATGGCAGCCCATCGTTCTATGGG No data
1002992955_1002992964 7 Left 1002992955 6:2254890-2254912 CCATCCAGATCCTGCCTGATGGC No data
Right 1002992964 6:2254920-2254942 CGTTCTATGGGTAATTAGGACGG No data
1002992955_1002992967 18 Left 1002992955 6:2254890-2254912 CCATCCAGATCCTGCCTGATGGC No data
Right 1002992967 6:2254931-2254953 TAATTAGGACGGGGCTCTGCTGG No data
1002992955_1002992968 19 Left 1002992955 6:2254890-2254912 CCATCCAGATCCTGCCTGATGGC No data
Right 1002992968 6:2254932-2254954 AATTAGGACGGGGCTCTGCTGGG No data
1002992955_1002992963 3 Left 1002992955 6:2254890-2254912 CCATCCAGATCCTGCCTGATGGC No data
Right 1002992963 6:2254916-2254938 CCATCGTTCTATGGGTAATTAGG No data
1002992955_1002992959 -6 Left 1002992955 6:2254890-2254912 CCATCCAGATCCTGCCTGATGGC No data
Right 1002992959 6:2254907-2254929 GATGGCAGCCCATCGTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002992955 Original CRISPR GCCATCAGGCAGGATCTGGA TGG (reversed) Intergenic
No off target data available for this crispr