ID: 1002994223

View in Genome Browser
Species Human (GRCh38)
Location 6:2267979-2268001
Sequence TACCCCCCTCCTCTCTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002994223_1002994227 22 Left 1002994223 6:2267979-2268001 CCAAAAGAGAGAGGAGGGGGGTA No data
Right 1002994227 6:2268024-2268046 GATGAAGCATGGAATAACCGTGG No data
1002994223_1002994228 27 Left 1002994223 6:2267979-2268001 CCAAAAGAGAGAGGAGGGGGGTA No data
Right 1002994228 6:2268029-2268051 AGCATGGAATAACCGTGGCAAGG No data
1002994223_1002994226 11 Left 1002994223 6:2267979-2268001 CCAAAAGAGAGAGGAGGGGGGTA No data
Right 1002994226 6:2268013-2268035 TTGCTTGTATGGATGAAGCATGG No data
1002994223_1002994225 0 Left 1002994223 6:2267979-2268001 CCAAAAGAGAGAGGAGGGGGGTA No data
Right 1002994225 6:2268002-2268024 TATGGAAGAGATTGCTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002994223 Original CRISPR TACCCCCCTCCTCTCTCTTT TGG (reversed) Intergenic
No off target data available for this crispr