ID: 1002994226 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:2268013-2268035 |
| Sequence | TTGCTTGTATGGATGAAGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1002994223_1002994226 | 11 | Left | 1002994223 | 6:2267979-2268001 | CCAAAAGAGAGAGGAGGGGGGTA | No data | ||
| Right | 1002994226 | 6:2268013-2268035 | TTGCTTGTATGGATGAAGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1002994226 | Original CRISPR | TTGCTTGTATGGATGAAGCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||