ID: 1002994226

View in Genome Browser
Species Human (GRCh38)
Location 6:2268013-2268035
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002994223_1002994226 11 Left 1002994223 6:2267979-2268001 CCAAAAGAGAGAGGAGGGGGGTA No data
Right 1002994226 6:2268013-2268035 TTGCTTGTATGGATGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002994226 Original CRISPR TTGCTTGTATGGATGAAGCA TGG Intergenic
No off target data available for this crispr