ID: 1002994992

View in Genome Browser
Species Human (GRCh38)
Location 6:2274612-2274634
Sequence GTAAACTAAAGGCAATGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002994992_1002994998 24 Left 1002994992 6:2274612-2274634 CCTCACCATTGCCTTTAGTTTAC No data
Right 1002994998 6:2274659-2274681 TTTCCATTACTGCCCTGAAAAGG No data
1002994992_1002995000 29 Left 1002994992 6:2274612-2274634 CCTCACCATTGCCTTTAGTTTAC No data
Right 1002995000 6:2274664-2274686 ATTACTGCCCTGAAAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002994992 Original CRISPR GTAAACTAAAGGCAATGGTG AGG (reversed) Intergenic
No off target data available for this crispr