ID: 1003002863

View in Genome Browser
Species Human (GRCh38)
Location 6:2352236-2352258
Sequence TACCCTATGCTGCTGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003002861_1003002863 8 Left 1003002861 6:2352205-2352227 CCTTTTCTACTAGCTAATCTAGT No data
Right 1003002863 6:2352236-2352258 TACCCTATGCTGCTGGTGAAAGG No data
1003002860_1003002863 13 Left 1003002860 6:2352200-2352222 CCATTCCTTTTCTACTAGCTAAT No data
Right 1003002863 6:2352236-2352258 TACCCTATGCTGCTGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003002863 Original CRISPR TACCCTATGCTGCTGGTGAA AGG Intergenic
No off target data available for this crispr