ID: 1003002863 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:2352236-2352258 |
Sequence | TACCCTATGCTGCTGGTGAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1003002861_1003002863 | 8 | Left | 1003002861 | 6:2352205-2352227 | CCTTTTCTACTAGCTAATCTAGT | No data | ||
Right | 1003002863 | 6:2352236-2352258 | TACCCTATGCTGCTGGTGAAAGG | No data | ||||
1003002860_1003002863 | 13 | Left | 1003002860 | 6:2352200-2352222 | CCATTCCTTTTCTACTAGCTAAT | No data | ||
Right | 1003002863 | 6:2352236-2352258 | TACCCTATGCTGCTGGTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1003002863 | Original CRISPR | TACCCTATGCTGCTGGTGAA AGG | Intergenic | ||