ID: 1003009512

View in Genome Browser
Species Human (GRCh38)
Location 6:2413629-2413651
Sequence GTGTTTGCATGCACGTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003009512_1003009516 30 Left 1003009512 6:2413629-2413651 CCTGAGCACGTGCATGCAAACAC No data
Right 1003009516 6:2413682-2413704 TTTTTTTTTCTTTCTGAGACAGG 0: 26
1: 919
2: 15534
3: 22242
4: 37711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003009512 Original CRISPR GTGTTTGCATGCACGTGCTC AGG (reversed) Intergenic
No off target data available for this crispr