ID: 1003009516

View in Genome Browser
Species Human (GRCh38)
Location 6:2413682-2413704
Sequence TTTTTTTTTCTTTCTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76432
Summary {0: 26, 1: 919, 2: 15534, 3: 22242, 4: 37711}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003009514_1003009516 -7 Left 1003009514 6:2413666-2413688 CCTTGAGAATCCTCTTTTTTTTT No data
Right 1003009516 6:2413682-2413704 TTTTTTTTTCTTTCTGAGACAGG 0: 26
1: 919
2: 15534
3: 22242
4: 37711
1003009512_1003009516 30 Left 1003009512 6:2413629-2413651 CCTGAGCACGTGCATGCAAACAC No data
Right 1003009516 6:2413682-2413704 TTTTTTTTTCTTTCTGAGACAGG 0: 26
1: 919
2: 15534
3: 22242
4: 37711
1003009513_1003009516 8 Left 1003009513 6:2413651-2413673 CCTGTGTATTATCAGCCTTGAGA No data
Right 1003009516 6:2413682-2413704 TTTTTTTTTCTTTCTGAGACAGG 0: 26
1: 919
2: 15534
3: 22242
4: 37711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003009516 Original CRISPR TTTTTTTTTCTTTCTGAGAC AGG Intergenic
Too many off-targets to display for this crispr