ID: 1003010769

View in Genome Browser
Species Human (GRCh38)
Location 6:2425347-2425369
Sequence CTGATTTTAAAAATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003010769_1003010772 7 Left 1003010769 6:2425347-2425369 CCTTTGTCCATTTTTAAAATCAG No data
Right 1003010772 6:2425377-2425399 CTGTTGTTGTAGTGAGTTGTAGG No data
1003010769_1003010773 8 Left 1003010769 6:2425347-2425369 CCTTTGTCCATTTTTAAAATCAG No data
Right 1003010773 6:2425378-2425400 TGTTGTTGTAGTGAGTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003010769 Original CRISPR CTGATTTTAAAAATGGACAA AGG (reversed) Intergenic
No off target data available for this crispr