ID: 1003011884

View in Genome Browser
Species Human (GRCh38)
Location 6:2434251-2434273
Sequence CTGTGTCATGGGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003011877_1003011884 5 Left 1003011877 6:2434223-2434245 CCTCTGTCTTTACCTGCCATGGC No data
Right 1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG No data
1003011875_1003011884 6 Left 1003011875 6:2434222-2434244 CCCTCTGTCTTTACCTGCCATGG No data
Right 1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG No data
1003011874_1003011884 23 Left 1003011874 6:2434205-2434227 CCTGTATTTTCAATTTGCCCTCT No data
Right 1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG No data
1003011878_1003011884 -7 Left 1003011878 6:2434235-2434257 CCTGCCATGGCCTGTGCTGTGTC No data
Right 1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003011884 Original CRISPR CTGTGTCATGGGAATGAGGA AGG Intergenic
No off target data available for this crispr