ID: 1003016031

View in Genome Browser
Species Human (GRCh38)
Location 6:2468213-2468235
Sequence GAGGGTAGACAGAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003016024_1003016031 1 Left 1003016024 6:2468189-2468211 CCAGCTTCAGAGTTGAGGAGAGG No data
Right 1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003016031 Original CRISPR GAGGGTAGACAGAGAGAGGA AGG Intergenic
No off target data available for this crispr