ID: 1003017048

View in Genome Browser
Species Human (GRCh38)
Location 6:2476498-2476520
Sequence CATTGAGCTGTTTGCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003017048_1003017055 29 Left 1003017048 6:2476498-2476520 CCACAGGAGCAAACAGCTCAATG No data
Right 1003017055 6:2476550-2476572 CATTAGGCTGTGACGTTGTCTGG No data
1003017048_1003017049 -8 Left 1003017048 6:2476498-2476520 CCACAGGAGCAAACAGCTCAATG No data
Right 1003017049 6:2476513-2476535 GCTCAATGCATTCCACACTGTGG No data
1003017048_1003017051 13 Left 1003017048 6:2476498-2476520 CCACAGGAGCAAACAGCTCAATG No data
Right 1003017051 6:2476534-2476556 GGACACACCCAGCAGCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003017048 Original CRISPR CATTGAGCTGTTTGCTCCTG TGG (reversed) Intergenic
No off target data available for this crispr