ID: 1003017049

View in Genome Browser
Species Human (GRCh38)
Location 6:2476513-2476535
Sequence GCTCAATGCATTCCACACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003017048_1003017049 -8 Left 1003017048 6:2476498-2476520 CCACAGGAGCAAACAGCTCAATG No data
Right 1003017049 6:2476513-2476535 GCTCAATGCATTCCACACTGTGG No data
1003017047_1003017049 -7 Left 1003017047 6:2476497-2476519 CCCACAGGAGCAAACAGCTCAAT No data
Right 1003017049 6:2476513-2476535 GCTCAATGCATTCCACACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003017049 Original CRISPR GCTCAATGCATTCCACACTG TGG Intergenic
No off target data available for this crispr