ID: 1003017051

View in Genome Browser
Species Human (GRCh38)
Location 6:2476534-2476556
Sequence GGACACACCCAGCAGCCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003017047_1003017051 14 Left 1003017047 6:2476497-2476519 CCCACAGGAGCAAACAGCTCAAT No data
Right 1003017051 6:2476534-2476556 GGACACACCCAGCAGCCATTAGG No data
1003017048_1003017051 13 Left 1003017048 6:2476498-2476520 CCACAGGAGCAAACAGCTCAATG No data
Right 1003017051 6:2476534-2476556 GGACACACCCAGCAGCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003017051 Original CRISPR GGACACACCCAGCAGCCATT AGG Intergenic
No off target data available for this crispr