ID: 1003017642

View in Genome Browser
Species Human (GRCh38)
Location 6:2480954-2480976
Sequence CTCATTCAGCTCATCTAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003017640_1003017642 12 Left 1003017640 6:2480919-2480941 CCGAGCAGCACAGCAGATCAACG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1003017642 6:2480954-2480976 CTCATTCAGCTCATCTAACTAGG 0: 1
1: 0
2: 0
3: 26
4: 225
1003017639_1003017642 13 Left 1003017639 6:2480918-2480940 CCCGAGCAGCACAGCAGATCAAC 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1003017642 6:2480954-2480976 CTCATTCAGCTCATCTAACTAGG 0: 1
1: 0
2: 0
3: 26
4: 225
1003017638_1003017642 14 Left 1003017638 6:2480917-2480939 CCCCGAGCAGCACAGCAGATCAA 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1003017642 6:2480954-2480976 CTCATTCAGCTCATCTAACTAGG 0: 1
1: 0
2: 0
3: 26
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003017642 Original CRISPR CTCATTCAGCTCATCTAACT AGG Intergenic
901184934 1:7366856-7366878 CTGATACAGCTCATCTGTCTGGG + Intronic
904026305 1:27505675-27505697 CTCACTCAGCTCAGCTCAGTGGG + Intergenic
904315803 1:29661957-29661979 CTCTTTGAGTTCATCTTACTTGG + Intergenic
906364816 1:45198590-45198612 CTCATTCCTCTCATCAAACAAGG + Intronic
907187454 1:52620860-52620882 CTGATTCAGCTAGTCTGACTGGG - Intergenic
907264804 1:53251248-53251270 TTCATTCAGCACATGTTACTAGG - Intronic
907544105 1:55244354-55244376 CTCAGTCTGCTCATTTACCTAGG + Intergenic
907690726 1:56662859-56662881 CTCATTCCTCTCATCAAACAAGG - Intronic
908243634 1:62209919-62209941 TTCATCCAGCTCCTCTAGCTCGG - Exonic
909722052 1:78784433-78784455 CTCATTCCTCTCATCAAACAAGG + Intergenic
909930267 1:81489624-81489646 CTTGTTGAGCTCATCTTACTTGG - Intronic
913589865 1:120313297-120313319 CTCATTCACCTCATCTATCAAGG - Intergenic
913618320 1:120585069-120585091 CTCATTCACCTCATCTATCAAGG + Intergenic
914571894 1:148925154-148925176 CTCATTCACCTCATCTATCAAGG - Intronic
914600942 1:149205106-149205128 CTCATTCACCTCATCTATCAAGG + Intergenic
914850961 1:151313842-151313864 ATCATTCAGCTGAACTACCTTGG - Intronic
915102110 1:153508042-153508064 CTCTTACAGCTCCTCTCACTTGG - Intergenic
916455257 1:164964602-164964624 CTCATTCTTCTCATCAAACATGG + Intergenic
916844120 1:168630897-168630919 CTCAATCACCTCCTCTATCTTGG - Intergenic
917759022 1:178135053-178135075 CTCATTCTTCTCATCAAACAAGG + Intronic
918223963 1:182462025-182462047 CTCTTTGAGTTCATCTTACTTGG - Intronic
918240643 1:182617029-182617051 CTCACAGAGCTCATCTACCTGGG - Intergenic
918962224 1:191295756-191295778 TTCATTCAGCTTACATAACTAGG - Intergenic
921091180 1:211844911-211844933 CTCATTCCTCTCATCAAACATGG - Intergenic
921999747 1:221464436-221464458 ATCATTGATCTCATCTAACTTGG + Intergenic
922909962 1:229207094-229207116 CTCATTCAGCCAGTCTACCTTGG - Intergenic
923950053 1:238940111-238940133 CTCATTCCTCTCATCAAACAAGG + Intergenic
1064497374 10:15926679-15926701 CTCCTTGAGTTCATCTTACTTGG + Intergenic
1065755806 10:28929612-28929634 CTCATTCTTCTCATCAAACAAGG - Intergenic
1068326865 10:55501637-55501659 CTGATTCACCTAATCTAACTTGG - Intronic
1068691735 10:59922982-59923004 CTCTTTCAGTTCATCCTACTTGG - Intergenic
1068797139 10:61095719-61095741 CTCATTCCTCTCATCAAACAAGG - Intergenic
1068919635 10:62469269-62469291 CTCATTCCTCTCATCAAACAAGG + Intronic
1069469727 10:68677231-68677253 CTCATTCCTCTCATCAAACGGGG + Intronic
1069553310 10:69379964-69379986 CTCATTTCGCTCAGCCAACTTGG + Exonic
1070084968 10:73228382-73228404 CTCAGTCAGCTCTTCTAAGGAGG + Intronic
1070931290 10:80262563-80262585 CTCATTCCTCTCATCAAACAAGG - Intergenic
1075026202 10:118985280-118985302 CTCTTTGAGTTCATCTTACTTGG - Intergenic
1078324929 11:10372024-10372046 CTCATTCCTCTCATCAAACAAGG - Intronic
1079398616 11:20087194-20087216 CTCTCTCTGCTCATCTTACTTGG - Intronic
1081466712 11:43325994-43326016 CTCATTCCTCTCATCAAACAGGG + Intronic
1085726292 11:78957796-78957818 CTGATTCATCTCATATAACAGGG + Intronic
1087329176 11:96757902-96757924 CTCATTCCTCTCATCAAACAAGG - Intergenic
1088734731 11:112719323-112719345 CTCATTGTGCCCATCCAACTGGG + Intergenic
1089435782 11:118464995-118465017 CTCATTCCTCTCATCAAACAAGG + Intronic
1091019835 11:132089016-132089038 CTCATTCCTCTCATCAAACAAGG - Intronic
1093618797 12:21262760-21262782 CTCTTTTAGCTCATCTTACTTGG + Intergenic
1095154772 12:38839148-38839170 CTCATTCAGCCCTTCCTACTGGG + Intronic
1095513982 12:42985375-42985397 CACAATCAGCTTATCTAAGTTGG + Intergenic
1102087740 12:110157504-110157526 CTCTTTCAGTTCATCTTTCTTGG + Intronic
1102387615 12:112523218-112523240 CTCATTCCTCTCATCAAACAAGG + Intergenic
1104129147 12:125875988-125876010 CTCATTCTGCTTTTCAAACTTGG + Intergenic
1104279549 12:127362255-127362277 CTCATTCCTCTCATCGAACAAGG - Intergenic
1104552555 12:129770513-129770535 TTCTTTCAGCTCATCTAACATGG + Intronic
1104635225 12:130434387-130434409 CTCATTCACCTCCGTTAACTGGG - Intronic
1106677418 13:31975722-31975744 CTCATTCCACTCATCAAACAAGG + Intergenic
1107118277 13:36770520-36770542 CTCATTCCTCTCATCAAACAAGG - Intergenic
1108055952 13:46485319-46485341 CTGAATCAGCTCAGCTAGCTAGG + Intergenic
1108206832 13:48098460-48098482 CTCATTCCTCTCATCAAACAAGG - Intergenic
1109947462 13:69455950-69455972 CTCATTCCTCTCATCTAACAAGG - Intergenic
1112013314 13:95310186-95310208 CTCATTCATCTCATCCAACCAGG + Intergenic
1113184043 13:107666081-107666103 CTCATTCCTCTCATCCAACAAGG - Intronic
1115823087 14:37233695-37233717 CTCATTCCTCTCATCAAACAAGG - Intronic
1116243875 14:42383027-42383049 CTCATTCCTCTCATCAAACAAGG + Intergenic
1120374357 14:83682000-83682022 CTCTTTGAGTTCATCTCACTTGG - Intergenic
1121802215 14:96784287-96784309 TTTATTAAGCTCCTCTAACTTGG + Intergenic
1129223201 15:74146853-74146875 CTCATTCCCCTCATCAAAGTGGG + Intergenic
1129497829 15:76003598-76003620 CTCTTTGAGTTCATCTTACTTGG - Intronic
1131675213 15:94664204-94664226 CTCTTTCAGACCATATAACTGGG - Intergenic
1137459102 16:48642048-48642070 CTCATTCCTCTCATCCAACAAGG + Intergenic
1139530448 16:67540048-67540070 CTCATACAGCTCATCGATCTGGG - Exonic
1141914394 16:87084913-87084935 CTCATTCCTCTCATCAAACAAGG + Intronic
1144119740 17:12140289-12140311 CTCATTCATCCCATGGAACTTGG + Intronic
1144326652 17:14188752-14188774 CTCATTCCTCTCATCAAACACGG - Intronic
1144475530 17:15585616-15585638 CTCATTCCTCTCATCAAACACGG - Intronic
1146102322 17:29995181-29995203 CTCATTCTTCTCATCAAACAAGG - Intronic
1146958791 17:36954455-36954477 CTAATTCAGCTCATTAAACTTGG + Intronic
1148869961 17:50652031-50652053 CTTTTGCAGCTCATCTGACTTGG - Intronic
1150694094 17:67389348-67389370 CTAATTCAGCTAATCTCCCTAGG - Intronic
1151136534 17:71951322-71951344 CTCATTCTCCTCATCTAAAATGG + Intergenic
1154301715 18:13199486-13199508 CTCTTTGAGCTTGTCTAACTTGG + Intergenic
1155611448 18:27672278-27672300 TTCATTCAGTTCAGCTAGCTGGG + Intergenic
1156236845 18:35213950-35213972 CTCTTTGAGTTCATCTTACTTGG + Intergenic
1156575513 18:38310967-38310989 CTTTCTCAGCTCATCCAACTGGG + Intergenic
1156888383 18:42161993-42162015 CTCATTCTTCTCATCAAACAAGG - Intergenic
1157187786 18:45555076-45555098 CTTATTCAGCTCATTCAATTTGG - Intronic
1157768468 18:50323740-50323762 CTCATTCCCCTCATCAAACAAGG + Intergenic
1158229134 18:55234235-55234257 CTCATTCAGGTCCTCTAATGTGG - Intronic
1160177306 18:76606183-76606205 CACATTCAGGCCATGTAACTTGG - Intergenic
1162324484 19:9990989-9991011 CTCATGCAGTTCATCTGCCTTGG - Intronic
1162947729 19:14053956-14053978 CTCATTCATCTCCTCTGCCTGGG + Exonic
1167151722 19:47713856-47713878 CTCATCCATATCAGCTAACTTGG + Intronic
1167730743 19:51252543-51252565 CTCATTCCGACCATCTAACATGG + Intronic
925639951 2:5977914-5977936 CTCAGTCAGCTTATCTAAAAGGG + Intergenic
926965052 2:18400773-18400795 GTCCTTCATCTCTTCTAACTGGG - Intergenic
928464576 2:31511638-31511660 CTCATTCTTCTCATCCAACAAGG - Intergenic
929065343 2:37967688-37967710 CTCATTCCTCTCATCGAACAAGG + Intronic
930728294 2:54703722-54703744 CTCATTAAGGTCATGTAATTTGG + Intergenic
931429997 2:62201618-62201640 CTCATTCTGCAAATGTAACTTGG + Intronic
933600737 2:84327243-84327265 CTCATTAATCTCATATTACTGGG - Intergenic
935281722 2:101523520-101523542 CTCATTCCTCTCATCAAACAAGG - Intergenic
935601162 2:104922816-104922838 CTCATTGAGTTCATCCTACTTGG - Intergenic
937861221 2:126712041-126712063 CTCATTCCTCTCATCAAACAAGG + Intergenic
939291175 2:140196854-140196876 CTCATTCATCTCATGAAACAAGG - Intergenic
941320483 2:164048349-164048371 TTCTTTCTGCACATCTAACTTGG - Intergenic
941620001 2:167766700-167766722 CTCATTCCTCTCATCAAACAAGG - Intergenic
941634329 2:167919199-167919221 CTCATTCCTCTCATCAAACAAGG + Intergenic
943399819 2:187393797-187393819 CTGATTCAGGTCATCTTGCTTGG + Intronic
945424618 2:209684901-209684923 CTCATTTAGCACATCAAAGTTGG - Intronic
947355564 2:229291471-229291493 CTCATTGCGCTCATCAAACAAGG + Intergenic
1172350737 20:34238127-34238149 CTCTTTGAGTTCATCTTACTTGG + Intronic
1173382869 20:42561688-42561710 CTCCTTTAGCACATCTAGCTTGG - Intronic
1175078413 20:56395700-56395722 CTCCTGCATCTCATCAAACTCGG + Exonic
1178145176 21:29731144-29731166 CTCATTCCTCTCATCAAACAAGG - Intronic
1178243528 21:30929965-30929987 CTCATTCCTCTCATCAAACAGGG - Intergenic
1180249374 21:46570881-46570903 CTCTTTGAGTTCATCTTACTTGG - Intergenic
952084745 3:29804977-29804999 CTCATTCAGTACATATCACTGGG - Intronic
952433156 3:33245897-33245919 CTTATTCAACTCATCTATTTGGG - Intergenic
956629416 3:71300629-71300651 CTCTTTCTGCCCATGTAACTGGG + Intronic
961006600 3:123409842-123409864 CTTTCTCAGCTCATCCAACTGGG - Intronic
963782003 3:149495729-149495751 TTCCTTCAGCTCAGCAAACTTGG - Intronic
964602987 3:158523758-158523780 CTCATTCCTCTCATCAAACATGG - Intronic
964603542 3:158531330-158531352 CTCATTCAACTCTTCTCACCTGG - Intronic
965053614 3:163685056-163685078 CTCATTCTTCTCATCAAACAAGG + Intergenic
967014674 3:185471097-185471119 CTCATTCATCTCATCAAACAAGG - Intronic
969331887 4:6478526-6478548 CTCACTCAGCACATCGAACAGGG - Intronic
970082718 4:12306153-12306175 CTCATTTAGCTGATTTATCTTGG + Intergenic
970481014 4:16474623-16474645 CTCATTCCTTTCATCAAACTAGG + Intergenic
970693789 4:18650757-18650779 CTCTTTTAGTTCATCTTACTTGG - Intergenic
972056364 4:34807514-34807536 TACAGTCAGCTGATCTAACTTGG - Intergenic
972336028 4:38107742-38107764 CTCATTCATCCCCTCTAAGTTGG - Intronic
972969761 4:44558964-44558986 CTCATTCTGATCTTCCAACTAGG - Intergenic
975103038 4:70536013-70536035 CTCATTCCTCTCATCAAACATGG - Intergenic
975652791 4:76611285-76611307 CTCATTCTGATTATTTAACTTGG + Intronic
976586031 4:86798199-86798221 CTCATTCGTCTCATCAAACAAGG - Intronic
978332518 4:107629908-107629930 CTCATTCCTCTCATCAAACAAGG + Intronic
978877234 4:113656462-113656484 CTGATTGTGCTCATGTAACTAGG + Intronic
978970854 4:114804210-114804232 CTCCTTCAGCTCCTATAATTTGG - Intergenic
979384121 4:120043729-120043751 CTCTTTCAGTTCATCTTGCTTGG - Intergenic
980218810 4:129887055-129887077 CTCATTCCTTTCATCTAACAAGG + Intergenic
980512112 4:133806527-133806549 CTCATTCTGTTTATCTAACTAGG + Intergenic
981089620 4:140719353-140719375 CTCACTCATGTAATCTAACTAGG + Intronic
982476470 4:155857646-155857668 CTCATTTGGGTCATATAACTTGG - Intronic
982676090 4:158377357-158377379 TAAATTGAGCTCATCTAACTGGG + Intronic
982947301 4:161640817-161640839 CTCTTTGAGTTCATCTTACTTGG - Intronic
984891688 4:184499559-184499581 CTCATTCTGCTCATCAAACAAGG + Intergenic
986037630 5:3955495-3955517 CTCATTCTGCACATTTATCTCGG + Intergenic
986102220 5:4623810-4623832 CTCTTTAAGTTCATCTTACTTGG - Intergenic
989786765 5:45341870-45341892 CTCACTCTGCTCATCAAACAAGG + Intronic
990590637 5:57259713-57259735 CTCATTCCTCTCATCAAACAAGG - Intronic
991999551 5:72422266-72422288 CTCATTCATCTCATCAAACATGG - Intergenic
992475194 5:77095091-77095113 CTCATTCCTCTCATCAAACAAGG - Intergenic
993711001 5:91225126-91225148 CTCAATCAGCACATCTGACCTGG + Intergenic
993784824 5:92117107-92117129 CTCATGCAGCTCATCTTAACAGG - Intergenic
993922516 5:93824753-93824775 CTCATTCCTCTCATCAAACAAGG - Intronic
994134760 5:96273290-96273312 CTTATCCAGCTCACCTAACTGGG - Intergenic
994733825 5:103526955-103526977 CTCATTCAGCCCACCTCACTGGG - Intergenic
995085310 5:108102046-108102068 CGAATTCAGCTCATCTCACTTGG - Intronic
995246724 5:109943837-109943859 CCCATTCTGCTTATCTAAGTAGG - Intergenic
996410706 5:123155932-123155954 CTCATCCAGCTCGACTTACTAGG - Exonic
996619163 5:125479080-125479102 GTCAATCAGCTCATCTAAATTGG + Intergenic
997182588 5:131845945-131845967 GTCTTTCAGTTCATCTTACTTGG - Intronic
997276103 5:132592474-132592496 CTCATTCCTCTCATCAAACAAGG - Intronic
997496368 5:134330328-134330350 CTCATTCCTCTCATCAAACGAGG - Intronic
998250508 5:140549029-140549051 CTCCTTCAGCTCCTCCAGCTTGG - Exonic
1000119246 5:158180812-158180834 CTCTTTCAGCTCAGCTCCCTAGG + Intergenic
1000418384 5:161008778-161008800 CTCATCTAGCTAATCTACCTGGG - Intergenic
1000844128 5:166257871-166257893 CAAATTCAACTTATCTAACTTGG - Intergenic
1001976505 5:176004231-176004253 CTCATTCCTCTCATCAAACAAGG - Intronic
1002240921 5:177839540-177839562 CTCATTCCTCTCATCAAACAAGG + Intergenic
1003017642 6:2480954-2480976 CTCATTCAGCTCATCTAACTAGG + Intergenic
1003383110 6:5643004-5643026 CTCTTTAAGCTCATCTCTCTGGG - Intronic
1003526735 6:6904428-6904450 TACTTACAGCTCATCTAACTTGG - Intergenic
1004829718 6:19463836-19463858 CTCTTTCGGCACATCTAGCTTGG - Intergenic
1005885241 6:30092450-30092472 CTCATTCCCTTCTTCTAACTTGG - Intergenic
1010040331 6:71374577-71374599 CTCATTCTTCTCATCAAACAAGG + Intergenic
1010099487 6:72087443-72087465 CTCATTCCTCTCATCAAACAAGG - Intronic
1013392049 6:109695404-109695426 CTCATTCCTCTCATCAAACATGG - Intronic
1013460510 6:110370872-110370894 CTCATTCCTCTCATCAAACAAGG + Intergenic
1013468756 6:110441717-110441739 CTCATTCCTCTCATCAAACAAGG + Intronic
1016187753 6:141219088-141219110 CTCTTTGAGTTCATCTTACTTGG - Intergenic
1016588131 6:145712759-145712781 CTCATTCATCTCATCAAACAAGG + Intronic
1017452136 6:154564076-154564098 CCCATTCAACTCACCTATCTGGG + Intergenic
1018537753 6:164839507-164839529 CTCGTTCTTCTCATCTAACAAGG - Intergenic
1018597542 6:165499118-165499140 CTCCTTCAGACCATCTAACAAGG + Intronic
1020731476 7:11886680-11886702 CTCATTCCTCTCATCAAACAAGG - Intergenic
1020966531 7:14876644-14876666 CAAATTCAGCTCATGCAACTTGG + Intronic
1021860337 7:24899838-24899860 CTGATTCAACTCATCTAAAGTGG - Intronic
1022882522 7:34602866-34602888 CTCATTCATCTCATCAGACAAGG - Intergenic
1023222895 7:37938399-37938421 CTCATTCCTCTCATCAAACAAGG - Intronic
1023688443 7:42761746-42761768 CTCATTTAAATCATGTAACTTGG - Intergenic
1026445569 7:70481767-70481789 GTCTTTAACCTCATCTAACTAGG - Intronic
1026521456 7:71121726-71121748 CTCATCTAGCTCATCTAGATTGG - Intergenic
1027376021 7:77550674-77550696 CTCATTCCTCTCATCAAACAAGG - Intronic
1027573086 7:79896335-79896357 CTTATTCAGCACCTCTAGCTGGG - Intergenic
1028140090 7:87263824-87263846 CTGCTTCAGCTCACCTAAGTGGG + Intergenic
1031082578 7:117272780-117272802 CTTTTTCAGATCATCTAAGTAGG + Intergenic
1032071478 7:128810155-128810177 CTCACACAGGTCTTCTAACTTGG - Exonic
1032253653 7:130279637-130279659 CTCATCAAAGTCATCTAACTTGG - Exonic
1034592004 7:152148946-152148968 CACCTTCAGCTCATCTGGCTTGG + Exonic
1036127978 8:6081276-6081298 CTTATTCAGCTGATTTAACTTGG + Intergenic
1037191666 8:16133431-16133453 CTCATTTCTCTCATCAAACTAGG - Intronic
1037489360 8:19383044-19383066 CTCTTTAAGTTCATCTCACTTGG + Intronic
1037821945 8:22139336-22139358 CTCATTCAGCTCCTCTGCCAGGG - Intronic
1037862994 8:22419547-22419569 CTCATTCATCTCAGGGAACTGGG - Exonic
1038853521 8:31304813-31304835 CTCATTCCTCTCATCAAACAAGG - Intergenic
1039402831 8:37285874-37285896 CTCATTCTTCTCATCAAACAAGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040675737 8:49747392-49747414 CTCTTTTAGTTCATCTTACTTGG - Intergenic
1041954224 8:63539631-63539653 CTCCTTCAGATAATCTAAGTGGG + Intergenic
1042724329 8:71856678-71856700 CTCTTTTAGTTCATCTTACTTGG + Intronic
1043104891 8:76095717-76095739 CTCTTTGAGTTCATCTTACTTGG + Intergenic
1043648683 8:82559072-82559094 CTCATTGTCCTCAGCTAACTTGG + Intergenic
1043890253 8:85645775-85645797 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043891868 8:85657965-85657987 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043894236 8:85724732-85724754 CTCATTCCTCTCATCAAACAAGG - Intergenic
1043894592 8:85727817-85727839 CTCATTCCTCTCATCAAACAAGG - Intergenic
1043894948 8:85730902-85730924 CTCATTCCTCTCATCAAACAAGG - Intergenic
1043895304 8:85733987-85734009 CTCATTCCTCTCATCAAACAAGG - Intergenic
1043897372 8:85747821-85747843 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043897728 8:85750909-85750931 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043898084 8:85753994-85754016 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043899698 8:85766189-85766211 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043901305 8:85778382-85778404 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043901660 8:85781467-85781489 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043903270 8:85793657-85793679 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043904881 8:85805850-85805872 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043906492 8:85818041-85818063 CTCATTCCTCTCATCAAACAAGG + Intergenic
1043953298 8:86333778-86333800 CTCATTCTTCTCATCAAACAAGG - Intergenic
1044889613 8:96819531-96819553 CTCATTCTGCTCATCAAACAAGG - Intronic
1045916725 8:107481122-107481144 CTAATTCATCTCATCAAACAAGG + Intronic
1046305876 8:112366328-112366350 CTCATTCCTCTCATCAAACAAGG + Intronic
1046667295 8:117018438-117018460 CTTATTCAGCACATCTCAATTGG + Intronic
1046843793 8:118891884-118891906 CTCATTCCTCTCATCAAACAAGG + Intergenic
1047265859 8:123308276-123308298 CTCCTTCAGTTAATCTTACTTGG + Intergenic
1048122010 8:131592188-131592210 CTCATTCCTCTCATCAAACATGG - Intergenic
1049458070 8:142704452-142704474 CTCATTCCTCTCATCAAACAAGG - Exonic
1052666813 9:31505785-31505807 CTAATGCAGCTCCTCTAACTAGG - Intergenic
1053098177 9:35347333-35347355 CTCATGCAGTTCAACTGACTTGG + Intronic
1061722324 9:132560208-132560230 ATCACTCATCTCATCCAACTGGG - Intronic
1186457641 X:9722553-9722575 CTCACTCAGCTCAGCTCACCAGG + Intergenic
1187154102 X:16707855-16707877 CCCATGCAGCTCATGTAGCTGGG - Intronic
1187169449 X:16836881-16836903 CTCATTCAGCTCACCTATGAGGG + Intronic
1188028287 X:25234456-25234478 CTCATTCCCCTCATCAAACAAGG + Intergenic
1190121252 X:47661087-47661109 CTCAATCAGTTCGCCTAACTCGG + Intergenic
1192730363 X:73797237-73797259 CTCATTATGCTCATCTAAACTGG - Intergenic
1194548361 X:95267006-95267028 CTCATTCCTCTCATCAAACATGG + Intergenic
1195931254 X:110079191-110079213 CTCATTCCTCTCATCAAACAAGG - Intronic
1198668560 X:139052541-139052563 CTCATTCATCTCATCAAACAAGG - Intronic
1199975497 X:152892797-152892819 CTCAATCAACTCATCTGACTTGG - Intergenic
1200768211 Y:7099154-7099176 CTCATTAATCTCATCAAACAAGG + Intergenic
1202046797 Y:20743684-20743706 CGCATTCATCTCATCAAACAAGG - Intergenic