ID: 1003018979

View in Genome Browser
Species Human (GRCh38)
Location 6:2493595-2493617
Sequence GATCAGAGATTGCGCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003018979_1003018980 -1 Left 1003018979 6:2493595-2493617 CCAGGCTGGCGCAATCTCTGATC No data
Right 1003018980 6:2493617-2493639 CACTGCAACCTCCGCCTCCCAGG 0: 33522
1: 160300
2: 208179
3: 148545
4: 88541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003018979 Original CRISPR GATCAGAGATTGCGCCAGCC TGG (reversed) Intergenic
No off target data available for this crispr