ID: 1003018980

View in Genome Browser
Species Human (GRCh38)
Location 6:2493617-2493639
Sequence CACTGCAACCTCCGCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 639087
Summary {0: 33522, 1: 160300, 2: 208179, 3: 148545, 4: 88541}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003018978_1003018980 0 Left 1003018978 6:2493594-2493616 CCCAGGCTGGCGCAATCTCTGAT No data
Right 1003018980 6:2493617-2493639 CACTGCAACCTCCGCCTCCCAGG 0: 33522
1: 160300
2: 208179
3: 148545
4: 88541
1003018979_1003018980 -1 Left 1003018979 6:2493595-2493617 CCAGGCTGGCGCAATCTCTGATC No data
Right 1003018980 6:2493617-2493639 CACTGCAACCTCCGCCTCCCAGG 0: 33522
1: 160300
2: 208179
3: 148545
4: 88541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003018980 Original CRISPR CACTGCAACCTCCGCCTCCC AGG Intergenic
Too many off-targets to display for this crispr