ID: 1003023186

View in Genome Browser
Species Human (GRCh38)
Location 6:2529825-2529847
Sequence GCTGCGTTGCAGTCACATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003023185_1003023186 -7 Left 1003023185 6:2529809-2529831 CCAGAAATAGACAGTGGCTGCGT No data
Right 1003023186 6:2529825-2529847 GCTGCGTTGCAGTCACATTCAGG No data
1003023183_1003023186 20 Left 1003023183 6:2529782-2529804 CCGTTAAACTTGGAAAGCAGGTG No data
Right 1003023186 6:2529825-2529847 GCTGCGTTGCAGTCACATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003023186 Original CRISPR GCTGCGTTGCAGTCACATTC AGG Intergenic
No off target data available for this crispr