ID: 1003023404

View in Genome Browser
Species Human (GRCh38)
Location 6:2531315-2531337
Sequence GAGAATGCCCACCCACACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003023395_1003023404 22 Left 1003023395 6:2531270-2531292 CCTCCTTTCTCTGCTTTTTGCTG No data
Right 1003023404 6:2531315-2531337 GAGAATGCCCACCCACACTGGGG No data
1003023396_1003023404 19 Left 1003023396 6:2531273-2531295 CCTTTCTCTGCTTTTTGCTGTAT No data
Right 1003023404 6:2531315-2531337 GAGAATGCCCACCCACACTGGGG No data
1003023401_1003023404 -10 Left 1003023401 6:2531302-2531324 CCTCAAAGGATTGGAGAATGCCC No data
Right 1003023404 6:2531315-2531337 GAGAATGCCCACCCACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003023404 Original CRISPR GAGAATGCCCACCCACACTG GGG Intergenic
No off target data available for this crispr