ID: 1003026008

View in Genome Browser
Species Human (GRCh38)
Location 6:2556453-2556475
Sequence CGTGCACCCCAGGGCCTACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003026004_1003026008 -7 Left 1003026004 6:2556437-2556459 CCACATTTTAGCTCCTCGTGCAC No data
Right 1003026008 6:2556453-2556475 CGTGCACCCCAGGGCCTACGAGG No data
1003026002_1003026008 10 Left 1003026002 6:2556420-2556442 CCAGTTCTCTTCTCATCCCACAT No data
Right 1003026008 6:2556453-2556475 CGTGCACCCCAGGGCCTACGAGG No data
1003026003_1003026008 -6 Left 1003026003 6:2556436-2556458 CCCACATTTTAGCTCCTCGTGCA No data
Right 1003026008 6:2556453-2556475 CGTGCACCCCAGGGCCTACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003026008 Original CRISPR CGTGCACCCCAGGGCCTACG AGG Intergenic
No off target data available for this crispr