ID: 1003026959

View in Genome Browser
Species Human (GRCh38)
Location 6:2563688-2563710
Sequence CTGTGGATCTGGAGCTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003026959_1003026966 20 Left 1003026959 6:2563688-2563710 CCATGGGAGCTCCAGATCCACAG No data
Right 1003026966 6:2563731-2563753 TGTGTGTCAGTGTTTGCTTGTGG No data
1003026959_1003026962 -7 Left 1003026959 6:2563688-2563710 CCATGGGAGCTCCAGATCCACAG No data
Right 1003026962 6:2563704-2563726 TCCACAGCCCTTTGGTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003026959 Original CRISPR CTGTGGATCTGGAGCTCCCA TGG (reversed) Intergenic
No off target data available for this crispr