ID: 1003028662

View in Genome Browser
Species Human (GRCh38)
Location 6:2581009-2581031
Sequence ATGTACCCCATTAAGTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003028659_1003028662 26 Left 1003028659 6:2580960-2580982 CCTATTTGTCTGCTTTAATTTGT No data
Right 1003028662 6:2581009-2581031 ATGTACCCCATTAAGTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003028662 Original CRISPR ATGTACCCCATTAAGTTGTA AGG Intergenic
No off target data available for this crispr