ID: 1003030730

View in Genome Browser
Species Human (GRCh38)
Location 6:2598238-2598260
Sequence CCACGTAGAAACAGCTCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003030723_1003030730 3 Left 1003030723 6:2598212-2598234 CCTCTAGATGCTATACCGCACTT No data
Right 1003030730 6:2598238-2598260 CCACGTAGAAACAGCTCCGGGGG No data
1003030722_1003030730 20 Left 1003030722 6:2598195-2598217 CCACAGACATATGGCTTCCTCTA No data
Right 1003030730 6:2598238-2598260 CCACGTAGAAACAGCTCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003030730 Original CRISPR CCACGTAGAAACAGCTCCGG GGG Intergenic
No off target data available for this crispr