ID: 1003030747

View in Genome Browser
Species Human (GRCh38)
Location 6:2598444-2598466
Sequence TTAATTCTACACTTAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003030743_1003030747 17 Left 1003030743 6:2598404-2598426 CCACACAAGGGCCAGTTATACGT No data
Right 1003030747 6:2598444-2598466 TTAATTCTACACTTAGAGCAAGG No data
1003030746_1003030747 6 Left 1003030746 6:2598415-2598437 CCAGTTATACGTCAGGTTCGGAG No data
Right 1003030747 6:2598444-2598466 TTAATTCTACACTTAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003030747 Original CRISPR TTAATTCTACACTTAGAGCA AGG Intergenic
No off target data available for this crispr