ID: 1003033342

View in Genome Browser
Species Human (GRCh38)
Location 6:2621647-2621669
Sequence TTCTATCTTAAAACATATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003033342_1003033343 3 Left 1003033342 6:2621647-2621669 CCTTCATATGTTTTAAGATAGAA No data
Right 1003033343 6:2621673-2621695 ATATTTATATAACAAGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003033342 Original CRISPR TTCTATCTTAAAACATATGA AGG (reversed) Intergenic
No off target data available for this crispr