ID: 1003035856

View in Genome Browser
Species Human (GRCh38)
Location 6:2639728-2639750
Sequence CTCTAAATGAGGAGGTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003035856_1003035862 14 Left 1003035856 6:2639728-2639750 CCAGATCACCTCCTCATTTAGAG 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1003035862 6:2639765-2639787 GAGAGATGACATGCCAAAAACGG 0: 1
1: 0
2: 2
3: 23
4: 255
1003035856_1003035863 26 Left 1003035856 6:2639728-2639750 CCAGATCACCTCCTCATTTAGAG 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1003035863 6:2639777-2639799 GCCAAAAACGGAAACCTCACAGG 0: 1
1: 0
2: 0
3: 10
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003035856 Original CRISPR CTCTAAATGAGGAGGTGATC TGG (reversed) Intergenic
903220462 1:21866349-21866371 CTATAGAGGAGGAGGGGATCAGG - Intronic
906182683 1:43835465-43835487 TTCTAAATGAGGGGTTGATTTGG + Intronic
909873366 1:80773253-80773275 CTATACAAGAGCAGGTGATCAGG - Intergenic
910963126 1:92783115-92783137 TTCTAAATGTGCAGGTGGTCTGG - Intronic
911086946 1:93986766-93986788 CTATAAAGGAGGAGGTTATTGGG + Intergenic
911088135 1:93996528-93996550 CACTCAATGAGGAGCTGAACAGG - Intronic
912709638 1:111941272-111941294 CTCTTTGTGAGGAGGTAATCTGG + Intronic
916058929 1:161085978-161086000 ATCTAAATGAGGAGGGGGCCAGG - Intronic
917605262 1:176621716-176621738 CTGTCAGTGAGGAGTTGATCAGG + Intronic
1063523754 10:6764258-6764280 CTCTAACTTAATAGGTGATCAGG - Intergenic
1064227485 10:13500375-13500397 TTCTGAATGAGTAGGTGATGAGG + Intronic
1064486850 10:15801588-15801610 CTCTAGATTAGGAGGTCATAAGG + Intronic
1065673451 10:28147793-28147815 CAATAAATCAGAAGGTGATCTGG - Intronic
1066668598 10:37812731-37812753 CTCTAGATGAGGAGGGCATAAGG + Intronic
1067513417 10:46914457-46914479 CTCTAAATGGGCTGCTGATCTGG - Intronic
1067648835 10:48137385-48137407 CTCTAAATGGGCTGCTGATCTGG + Intergenic
1067949915 10:50724486-50724508 CAGTTAATGAGGAGGTGCTCTGG - Intergenic
1068487656 10:57680473-57680495 CTCTGAAAGAGAAGGTGATTTGG - Intergenic
1070168575 10:73915679-73915701 CTATAAATGATCAGGTGTTCAGG + Intronic
1070885247 10:79889686-79889708 CAGTTAATGAGGAGGTGCTCTGG - Intergenic
1071816530 10:89237880-89237902 CTCTAAATCAGGAGGTCATAAGG + Intronic
1077549176 11:3192378-3192400 CTCTAACAGAGGAGGGGAACGGG + Intergenic
1082642513 11:55681642-55681664 CTCTAAAAGAAGAGGTGAGCAGG + Intergenic
1085825810 11:79846026-79846048 ATCTAAAGAAGGTGGTGATCTGG + Intergenic
1085846964 11:80076989-80077011 CTCCTAATGAGGAGATGAACTGG - Intergenic
1086407081 11:86507615-86507637 CTCTATAGCAGGAGGAGATCTGG + Intronic
1087572117 11:99942225-99942247 CTCTAGATGAGTATGTGATCTGG + Intronic
1089061242 11:115627803-115627825 CTCTGAAAGAGGAGGTAAGCTGG + Intergenic
1089523500 11:119081385-119081407 TCTTAAATGAGGAGGTGATAAGG - Intronic
1092705411 12:11278791-11278813 ATCTAATTCAGAAGGTGATCTGG + Intergenic
1096819467 12:54222569-54222591 CTGTAAATGATGAGATGATGTGG + Intergenic
1098640608 12:72834689-72834711 ATCTAAAGGAGGATGTGAACTGG + Intergenic
1104269902 12:127273629-127273651 ATCTTAATAAGGAGGTGCTCCGG + Intergenic
1106468980 13:30038131-30038153 ATCTAAATGAGGAGGTGTTTGGG + Intergenic
1109309728 13:60678387-60678409 TTATAAATGAGGGGGTGCTCTGG + Intergenic
1112628222 13:101130324-101130346 ATACAAATGAGGAGGTGAACGGG - Intronic
1113077167 13:106478321-106478343 TTCTAAATGAGGAGGAGGGCAGG - Intergenic
1120386177 14:83848917-83848939 ATCTAAATGAGTAGGTAAGCCGG + Intergenic
1121059376 14:90890985-90891007 CTCTAAATGAGGAGTAGATGGGG - Intronic
1126142376 15:45448835-45448857 CTCTAAATGGGGAGGTGGGGAGG - Intergenic
1128231391 15:66037863-66037885 CTCTGGAAGAGGAGGTGATCGGG + Intronic
1128310999 15:66631806-66631828 CTCTCAATGAGGAGGTACTGGGG - Intronic
1128541240 15:68535081-68535103 ATCTAAATAAGGTGGTGATATGG - Intergenic
1129485460 15:75866982-75867004 CTATAAATGAGGAGATAACCAGG - Intronic
1130867649 15:87946212-87946234 CTCTGAAGGAGGAGGAGGTCAGG - Intronic
1138616194 16:58169237-58169259 CTTTAAAAGAGGGGGTGATGAGG + Intronic
1139061174 16:63253809-63253831 CTCTTTATGAGGCGGTGATATGG - Intergenic
1139298278 16:65921903-65921925 ATCAAAATGAGGAGGTCATGTGG + Intergenic
1144171677 17:12665094-12665116 CTCTAAATAGGGAGGGGCTCTGG - Intergenic
1149226388 17:54476501-54476523 CTAAAAATGAGGAGGGAATCTGG + Intergenic
1150624051 17:66830132-66830154 CTCTCAATGAGGAAGAGATAGGG + Intergenic
1152855740 17:82663909-82663931 CTCTGAAGGAGGTGGTGGTCCGG - Intronic
1163297609 19:16422250-16422272 CTCTGAACCAGGAGGTGACCGGG - Intronic
1165984491 19:39756100-39756122 CTCTGAGTGAGGAGGTCACCCGG + Intergenic
1166762806 19:45235343-45235365 CTGTGACTGAGGAGGGGATCTGG + Intronic
1167408498 19:49330557-49330579 CAGTAAAGGAGGAGGGGATCAGG + Intergenic
928730164 2:34222687-34222709 TTCTAAGTGAGGAGGTGAGGTGG + Intergenic
930266616 2:49207684-49207706 CTCCAAATAAGGAGGTCATAAGG + Intergenic
930366264 2:50443580-50443602 CTCTAAATCAGTATGTGATCTGG + Intronic
934615795 2:95769873-95769895 CTCTAAAGGATCAGGTGAGCTGG - Intergenic
934645097 2:96054685-96054707 CTCTAAAGGATCAGGTGAGCTGG + Intergenic
934838504 2:97610774-97610796 CTCTAAAGGATCAGGTGAGCTGG + Intergenic
934861337 2:97765730-97765752 CTATAAATGAGGAACTCATCAGG + Intronic
939513082 2:143131532-143131554 CTCTAAATTAGGAGCAGAGCAGG - Intronic
940979732 2:159987857-159987879 CTCTAAATGAGGTAAAGATCCGG + Intronic
945373267 2:209047835-209047857 CTTTAAAGGATGAGATGATCAGG - Intergenic
947471988 2:230409225-230409247 CTCTGGAGGATGAGGTGATCAGG - Intergenic
947494967 2:230628385-230628407 CTCTAAATGCGGAGGTGTCCCGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173691999 20:44967644-44967666 CTCTAAAGAAGGAAGTGTTCAGG + Intronic
1177003586 21:15643277-15643299 CTTGAAATGGGGAGGTTATCTGG - Intergenic
1180632467 22:17239215-17239237 CTTTAAATGAGGAGATTAGCCGG + Intergenic
950699568 3:14731364-14731386 CTCTGAATGTGGGGGTGATGTGG - Intronic
951181663 3:19666057-19666079 CTCTAAATTAAGATGTGTTCAGG - Intergenic
951337748 3:21444898-21444920 CCCAAAAAGAGGTGGTGATCAGG + Intronic
951779811 3:26349677-26349699 CTTTAAATGAGGATGTGATAGGG - Intergenic
954782569 3:53072217-53072239 CTCTACATGAGGCTGTGATAAGG + Intronic
961995785 3:131240804-131240826 CTCTAAGTGAGGAGATCATCTGG + Intronic
963601509 3:147382932-147382954 CTCTAAATGAGGGGGGGGTGGGG + Intergenic
965364199 3:167778159-167778181 CCCCAAATGAGCAGGTCATCAGG + Intronic
966244036 3:177786078-177786100 CTCTAAATGAGCAGGGGTTGGGG - Intergenic
970373908 4:15436757-15436779 CTCTAAAAGAGGAAGGGATTTGG + Intronic
973136157 4:46709160-46709182 CTCTCAGTGGGGAGGTGAGCTGG - Intergenic
974502002 4:62717540-62717562 CTCTTAATGAGTGGGTGATAAGG + Intergenic
980986176 4:139696890-139696912 CTCTAAATCAGGGGGTTATCAGG - Intronic
983976879 4:173945391-173945413 CTCCAAATGAGGCAGTGGTCCGG + Intergenic
985019623 4:185673928-185673950 CTCTAAGGGAGGAGGAAATCTGG - Intronic
991414151 5:66375150-66375172 CTTTACAGGAGGATGTGATCAGG + Intergenic
993788708 5:92178287-92178309 CTTAAAATAGGGAGGTGATCAGG - Intergenic
995570895 5:113480730-113480752 CTCTAAATCAAAAGGTGATTTGG + Intronic
995728563 5:115209940-115209962 CAGTTAATGAGGAGGTGCTCTGG - Intergenic
997863732 5:137443013-137443035 CCCTAAAGGAGGAGGTTTTCTGG + Intronic
1000618346 5:163455359-163455381 CTGTAAGGGAGGAGGTAATCAGG + Intronic
1003035856 6:2639728-2639750 CTCTAAATGAGGAGGTGATCTGG - Intergenic
1005501350 6:26431499-26431521 CACCTAATGAGGAGGTGAACAGG - Intergenic
1005582571 6:27248670-27248692 TTCTAGATGAGGAGATGAACAGG + Intronic
1008742611 6:54627687-54627709 CTCTAGATCAGGAGGTCATAAGG + Intergenic
1023255464 7:38308285-38308307 CTCCCAGTGAGGAGGTGATGAGG - Intergenic
1024271646 7:47646959-47646981 CTCCTAATGAGGGGGTGCTCTGG - Intergenic
1028135475 7:87219693-87219715 CTCAAGATGAGGAGGTGCGCGGG - Exonic
1028398797 7:90402972-90402994 CTCTACATCTGGAGGTTATCTGG - Intronic
1030315633 7:108111209-108111231 CTATAAATGTGGACTTGATCAGG - Intronic
1030619795 7:111776585-111776607 CTCAAAATGAGGAGAAGAACTGG + Intronic
1032920102 7:136535553-136535575 CTCTCGAGGAGTAGGTGATCGGG - Intergenic
1033006808 7:137574010-137574032 CTCCAAATGAGAAGGTAATGGGG - Intronic
1039339417 8:36630481-36630503 CTCTAAAGGCTGAGGTGGTCAGG + Intergenic
1041963091 8:63642552-63642574 CTGTAAAGGAGAAGGTGAGCAGG - Intergenic
1055332886 9:75202275-75202297 CTTTAGAAGAAGAGGTGATCTGG - Intergenic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1059064013 9:111063596-111063618 CTCTAAATGAGATGGTAATCTGG + Intergenic
1193787326 X:85775090-85775112 CTCAAAATTGGGAGGTGATCTGG - Intergenic
1202246070 Y:22821626-22821648 CTTTGAACGAGAAGGTGATCCGG - Intergenic
1202399058 Y:24455374-24455396 CTTTGAACGAGAAGGTGATCCGG - Intergenic
1202471722 Y:25214712-25214734 CTTTGAACGAGAAGGTGATCCGG + Intergenic