ID: 1003038342

View in Genome Browser
Species Human (GRCh38)
Location 6:2664455-2664477
Sequence CAGTGTGCATGCGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 303}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003038342_1003038355 6 Left 1003038342 6:2664455-2664477 CCCCAGCACACGCATGCACACTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1003038355 6:2664484-2664506 GTGCTGCGTGGCTGGGGGAGGGG 0: 1
1: 0
2: 8
3: 132
4: 2917
1003038342_1003038347 -2 Left 1003038342 6:2664455-2664477 CCCCAGCACACGCATGCACACTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1003038347 6:2664476-2664498 TGGCACCCGTGCTGCGTGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 105
1003038342_1003038354 5 Left 1003038342 6:2664455-2664477 CCCCAGCACACGCATGCACACTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1003038354 6:2664483-2664505 CGTGCTGCGTGGCTGGGGGAGGG 0: 1
1: 0
2: 4
3: 37
4: 452
1003038342_1003038353 4 Left 1003038342 6:2664455-2664477 CCCCAGCACACGCATGCACACTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1003038353 6:2664482-2664504 CCGTGCTGCGTGGCTGGGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 323
1003038342_1003038349 0 Left 1003038342 6:2664455-2664477 CCCCAGCACACGCATGCACACTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1003038349 6:2664478-2664500 GCACCCGTGCTGCGTGGCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 140
1003038342_1003038348 -1 Left 1003038342 6:2664455-2664477 CCCCAGCACACGCATGCACACTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1003038348 6:2664477-2664499 GGCACCCGTGCTGCGTGGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 120
1003038342_1003038346 -6 Left 1003038342 6:2664455-2664477 CCCCAGCACACGCATGCACACTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1003038346 6:2664472-2664494 ACACTGGCACCCGTGCTGCGTGG 0: 1
1: 0
2: 1
3: 7
4: 83
1003038342_1003038356 12 Left 1003038342 6:2664455-2664477 CCCCAGCACACGCATGCACACTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1003038356 6:2664490-2664512 CGTGGCTGGGGGAGGGGCAGAGG 0: 1
1: 3
2: 22
3: 251
4: 1821
1003038342_1003038350 1 Left 1003038342 6:2664455-2664477 CCCCAGCACACGCATGCACACTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1003038350 6:2664479-2664501 CACCCGTGCTGCGTGGCTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003038342 Original CRISPR CAGTGTGCATGCGTGTGCTG GGG (reversed) Exonic
900098514 1:950967-950989 CAGTGCTCCTCCGTGTGCTGGGG - Intronic
900187884 1:1341044-1341066 AGGTGTGCATGTGTGTGCAGGGG - Intronic
900581096 1:3409881-3409903 TTGTGTGCATGTGTGTGGTGTGG + Intronic
902074955 1:13777067-13777089 CTGTGTGCATGTGCGTGTTGTGG - Intronic
902678548 1:18026831-18026853 CATTGTGTATGCGTGTGTGGAGG - Intergenic
903072077 1:20731622-20731644 CGAGGTGCGTGCGTGTGCTGGGG + Intronic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
903673681 1:25051445-25051467 CATTGTGCAGGCGTGTGCACTGG - Intergenic
903883651 1:26529411-26529433 CAGTGTGAATGTGTGTGCTGGGG + Intergenic
905121426 1:35685125-35685147 GAGTGTGGATGCGTGTAATGTGG + Intergenic
905296136 1:36955537-36955559 GTGTGTGCATGCGTGTTCTCCGG - Intronic
905516249 1:38564172-38564194 GAGTGTGCATGTGTGTGAGGAGG + Intergenic
907244180 1:53097210-53097232 CAGGGTGCGTGAGTGTACTGAGG - Intronic
907311067 1:53539397-53539419 GGGTGTGCATTCATGTGCTGTGG - Intronic
910214618 1:84830521-84830543 AAGTGTGTAAGAGTGTGCTGTGG - Intronic
912490917 1:110062217-110062239 CAGTGTGGATGTATGTGTTGAGG - Intronic
912491810 1:110066595-110066617 CTGTGTGTATGCATGTGGTGGGG - Intronic
913456142 1:119033096-119033118 CAGTGTTCATGCCCGCGCTGCGG + Exonic
914941493 1:152027128-152027150 GAGTGTGCATGTGTTTCCTGTGG + Intergenic
915596358 1:156898491-156898513 CAGTGTGCAAGCGTGTACATGGG + Intronic
915609790 1:156982520-156982542 CTGTGTGCATGTGTGTGTTGGGG - Intronic
917355368 1:174121583-174121605 AAGTGTGCATTAGTGTGCTAGGG + Intergenic
919780143 1:201216231-201216253 CTGGGTGCATGTGTGTGTTGGGG + Intronic
919981451 1:202644713-202644735 CAGTGTGCATGTGTGTTGGGGGG + Intronic
922739720 1:228008254-228008276 GAGTGTGCATGCTTGTGGGGAGG - Intronic
922852405 1:228744746-228744768 CTGTGTGCATGAGTGTGCATGGG - Exonic
1062854585 10:773631-773653 CAGTGTGCCTGTGTGTGCCTGGG + Intergenic
1062944290 10:1448958-1448980 CAGGCTGCATGTGTGTCCTGTGG - Intronic
1063964915 10:11339379-11339401 CAGTGAGCATGCTGGGGCTGGGG + Intergenic
1064578576 10:16770455-16770477 CAGATTTCATGCCTGTGCTGCGG - Intronic
1067061295 10:43079170-43079192 GAGTGTGCATGTGTGAGCTGTGG - Intronic
1067180339 10:43980636-43980658 CAGTGTGGAGGTGTCTGCTGAGG - Intergenic
1070809918 10:79292556-79292578 CAGTGTGCTTGGGTGTGGTGGGG + Intronic
1071145386 10:82564233-82564255 AAGTGTGAATGCTTGAGCTGAGG + Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1072713932 10:97737051-97737073 AAGGGTGCTTGCCTGTGCTGGGG + Intergenic
1073337139 10:102718285-102718307 CTGTGTGTATGTGTGTGCTGAGG + Intronic
1073514565 10:104065038-104065060 CAGGGTGCATGCCTGGGCAGGGG + Intronic
1073644342 10:105284331-105284353 CAGTGTGCATTGCTGTGCTTTGG + Intergenic
1074516936 10:114179254-114179276 GAGTGCGCAGGCGTGCGCTGAGG + Exonic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1075654938 10:124155074-124155096 GAGTGTGCATGCATGTGTGGGGG - Intergenic
1076790851 10:132775947-132775969 CTGTGTGCATGTGTGTCCGGGGG + Intronic
1077480118 11:2810528-2810550 CAGAGAGCAAGCGTGTGCTCTGG - Intronic
1077538964 11:3137800-3137822 CAGTGTGTTTGTGTGTGATGAGG - Intronic
1077806873 11:5599307-5599329 AAGTGTGCATGTGTTTGTTGGGG + Intronic
1081816805 11:45949610-45949632 TAGTGTGCTTGCCTCTGCTGAGG - Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1084531542 11:69730669-69730691 AAGTGTGGAGGCGTGTTCTGGGG + Intergenic
1085273843 11:75285759-75285781 CAGGGTGCCTGCGTGTGTTGGGG + Intronic
1085926178 11:81024662-81024684 TTGTGTGCATGCGTGTGGTGGGG + Intergenic
1089481078 11:118805686-118805708 TAGTGTGTATGTGTGTGTTGGGG + Intergenic
1090081168 11:123613721-123613743 GAGTGTGCATGTGTGTGCCTTGG - Intronic
1090975473 11:131676461-131676483 CTGTGTACATGCGTGTGCGGGGG + Intronic
1091186141 11:133649569-133649591 ACGTGTGCTTGCCTGTGCTGCGG - Intergenic
1091215943 11:133901963-133901985 TGGTGTGCATGTGTGTGATGCGG - Intergenic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1093842319 12:23919110-23919132 CATTGTGCATGTGTGTGTTTGGG + Intronic
1094154397 12:27322751-27322773 CATTCTGCCTGTGTGTGCTGTGG + Exonic
1094209163 12:27872477-27872499 TAGTGTGCATTCGAGTTCTGGGG - Intergenic
1095388780 12:41680369-41680391 CAGTCTGCCTGACTGTGCTGGGG - Intergenic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1097053733 12:56238307-56238329 CTGTGTGCAGGTGTGTGTTGGGG - Exonic
1103961731 12:124613177-124613199 GGGTGTGGATACGTGTGCTGTGG - Intergenic
1104557883 12:129818415-129818437 AAGTGTGTATGTGTGTGGTGGGG + Intronic
1104579074 12:129996468-129996490 AAGTGGGCATGTGTGTCCTGAGG - Intergenic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1108709544 13:53018982-53019004 CACTGAGCATGAGTGGGCTGTGG - Intergenic
1110286145 13:73752413-73752435 CAGGGTGCATGTGTGTGGTGTGG - Intronic
1111235900 13:85406870-85406892 CAGTGTGCATGCCCCAGCTGAGG - Intergenic
1113993251 14:16045469-16045491 CAGTGTGTATGCGTGGGTTGCGG - Intergenic
1114612774 14:24053187-24053209 AAGTGTGAATGAGTATGCTGTGG - Intronic
1119756339 14:77122633-77122655 TAGTGTGCTTGGGTGTGTTGGGG - Intronic
1120865635 14:89293303-89293325 CAGTGTCTATTCGTTTGCTGGGG + Intronic
1121559985 14:94867283-94867305 CAGTGTGTGTGCGTGTGCATGGG - Intergenic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1122792408 14:104189828-104189850 CCGTGTGCATGCGTGTGTGCGGG - Intergenic
1122872466 14:104646232-104646254 GAGTGTGAATACCTGTGCTGTGG - Intergenic
1124000338 15:25754086-25754108 CACTGTGCATTCATGTGCTGCGG + Intronic
1124250936 15:28106353-28106375 CGGGGAGCATGCGTGTGGTGGGG + Intergenic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127629102 15:60809619-60809641 AAATGTGCATGTGTGTGGTGGGG - Intronic
1127742488 15:61925190-61925212 CTATTTGCATGCGTGTGTTGTGG - Intronic
1128371129 15:67040139-67040161 CAGTGTGGAGGTGAGTGCTGAGG + Intergenic
1130143528 15:81253801-81253823 CAGTGGGAATGGGTGTGCTGGGG + Intronic
1131003837 15:88959858-88959880 CAGTGTCTATGCAGGTGCTGGGG + Intergenic
1131876298 15:96810094-96810116 CAATGTCCCTGTGTGTGCTGAGG + Intergenic
1132505933 16:308726-308748 GTGTGTGCGTGCTTGTGCTGTGG - Intronic
1132691010 16:1181965-1181987 CTGTGTGCATGCGTGTGCGAGGG - Intronic
1133222196 16:4323562-4323584 GAGTGTGCGTGTGTGTGCCGGGG + Intronic
1133898485 16:9951179-9951201 CAGGGTGCATTCTTCTGCTGTGG - Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1136268956 16:29137270-29137292 CACTTTACATCCGTGTGCTGGGG - Intergenic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1137672048 16:50284699-50284721 CAGTGGGCAAGCCTGGGCTGAGG + Intronic
1137712078 16:50573456-50573478 CAGTGTGAAGCCGGGTGCTGCGG + Intronic
1137833827 16:51571246-51571268 CATTGTGCATACATGTGGTGAGG - Intergenic
1140072700 16:71665619-71665641 CTGTGTGTCTGCTTGTGCTGTGG + Intronic
1141688088 16:85581686-85581708 CAGTGTGCATTTCTGTGCTCAGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1141983444 16:87564208-87564230 CTGTGTGCGTGCTTGTGTTGGGG + Intergenic
1142072263 16:88097638-88097660 CACTTTACATCCGTGTGCTGGGG - Intronic
1142591562 17:1008436-1008458 CCGTGTGCGCGCGTGTGGTGAGG - Intronic
1142932482 17:3298780-3298802 CACTGTGCAGGCCTGTGCTCCGG + Intergenic
1143202082 17:5120239-5120261 CTCTCTGCATGCCTGTGCTGTGG + Intronic
1144600679 17:16610168-16610190 CAATGTGCCTGGGTGTGCAGGGG - Intergenic
1144879096 17:18421793-18421815 CTTTTTGCATGCCTGTGCTGTGG + Intergenic
1145153138 17:20522594-20522616 CTTTTTGCATGCCTGTGCTGTGG - Intergenic
1146241759 17:31235789-31235811 TTGTGTGTATGTGTGTGCTGAGG + Intronic
1147317136 17:39626475-39626497 GAGTGTGCAGGGGTGTGCCGGGG - Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1147581477 17:41629595-41629617 CTTTCTGCATGCCTGTGCTGTGG - Intergenic
1148228352 17:45915262-45915284 GAGTGTGTATGTGTGTGGTGTGG + Intronic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1149051895 17:52314887-52314909 GAGTGTGTATGTGTGTGTTGAGG - Intergenic
1149289132 17:55198407-55198429 CAGGATGCATGAGTGGGCTGTGG + Intergenic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1150292565 17:63990129-63990151 GAGTGTGTGTGCTTGTGCTGTGG - Intergenic
1151388493 17:73770119-73770141 CCCTGTGCCTGCGTGTGCTGGGG - Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152235963 17:79138984-79139006 CTGTGTGCATGTGTGTGAGGGGG - Intronic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1153199536 18:2634443-2634465 CAGTAAGCAAGCGTGTGGTGTGG + Intergenic
1153618101 18:6952437-6952459 TACTGTGCATGTGTGTGCGGGGG + Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154324511 18:13380207-13380229 CCTTGTGCATGTGGGTGCTGTGG + Intronic
1155901255 18:31393832-31393854 CAGTGTGTATGGTTGTGCTTTGG - Intronic
1156590574 18:38483196-38483218 AAATGTGCATGCATGTACTGTGG + Intergenic
1157533447 18:48441446-48441468 CAGTGTGACTGCGTGTGCTCAGG + Intergenic
1159274002 18:66192157-66192179 ATGTGTGCATGCGTGTGGAGAGG - Intergenic
1160404551 18:78636675-78636697 GAGTGTGCATGGGTGTGTAGAGG + Intergenic
1161322635 19:3648449-3648471 CTCTGTGCATGGGTGTCCTGGGG + Intronic
1164766683 19:30777684-30777706 CAGACTGCATGTGTGTGCTGAGG + Intergenic
1167082158 19:47283924-47283946 CAGTGTGCATCTGTGTGATTGGG + Intergenic
1167669922 19:50844856-50844878 CAGTGAGGATGTGTGTGCAGGGG + Intergenic
1168277883 19:55287118-55287140 CAGTGTGCCTGCGGGTGGGGGGG + Intronic
1168311447 19:55463035-55463057 CTGTGTGCATGTGTGTGTTTTGG - Intergenic
1168325155 19:55535091-55535113 AAGTGTGCATTCATCTGCTGGGG - Intronic
1168686513 19:58352464-58352486 CAGTGTGCCGAGGTGTGCTGCGG - Exonic
925133526 2:1511162-1511184 CAGTCTGCAGGGCTGTGCTGTGG - Intronic
925133533 2:1511191-1511213 CAGTCTGCAGGGCTGTGCTGTGG - Intronic
925406954 2:3612243-3612265 ATGTGTGCATGCGTGTGCGTGGG - Intronic
925462033 2:4072006-4072028 AAGTGTGCATGTGTGTGTGGTGG + Intergenic
925817554 2:7768447-7768469 TGGTGTGCATGGGTGTGGTGTGG - Intergenic
926642593 2:15253381-15253403 ATGTGTGTATGCGTGTGCTTAGG + Intronic
927429749 2:23017419-23017441 CAGGGTGCAGGCGTGTGGGGCGG - Intergenic
927653367 2:24926245-24926267 AAGTGTGCATGCATGTGCCTGGG + Intergenic
928171344 2:29006493-29006515 GAGTGTGTGTGCGTGTGCTCAGG + Intronic
928196035 2:29217378-29217400 CTGTGTGCATGGGTGGGGTGGGG + Intronic
929532186 2:42760277-42760299 CAGTGTGCAGGGGTGTGGGGAGG - Intergenic
929678930 2:43968869-43968891 CTGTGTGCATGAGTGTGGTGAGG - Intronic
930351787 2:50265758-50265780 AAGTGTGAATGAGTGTGGTGAGG - Intronic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
935227412 2:101065100-101065122 CAGTGTCCATGCAGGAGCTGTGG - Intronic
935375193 2:102388455-102388477 CTGTGTGATTGCCTGTGCTGTGG + Intronic
935812352 2:106810909-106810931 CAGTGAGCATGAGAGTGCAGTGG - Intronic
938119648 2:128624585-128624607 ATATGTGCATGCGTGTGGTGTGG - Intergenic
941181790 2:162268142-162268164 CAGTGTGCTAGCCTGTTCTGGGG - Exonic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
944199878 2:197095248-197095270 CAGTGTCCATGTTTGTACTGAGG + Intronic
946405905 2:219491964-219491986 CAGTGTGGATGTGTGTACAGGGG - Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947476764 2:230457171-230457193 CAGTGGGCAGGTCTGTGCTGGGG + Intronic
947704096 2:232260475-232260497 CAGGAAGCATGTGTGTGCTGTGG - Intronic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948527705 2:238582277-238582299 CACTGTGCATGAATTTGCTGTGG + Intergenic
948856162 2:240731684-240731706 CAGTGAGCTTGCCTGAGCTGGGG - Intronic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171471411 20:25374904-25374926 CACTCTGCATGCCTGTGCTATGG + Intronic
1171811773 20:29750388-29750410 CAGTGTGTGTGCGTGGGTTGCGG + Intergenic
1172780649 20:37435091-37435113 CTGTGTGCATGCATGTGCCTGGG + Intergenic
1173137737 20:40455059-40455081 CAGTGTTCTTAAGTGTGCTGTGG - Intergenic
1173969379 20:47139853-47139875 AAGTTTGCATGTGTGTGTTGGGG - Intronic
1175498897 20:59435436-59435458 CCGGGTGCATGTGTTTGCTGAGG + Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175776368 20:61656315-61656337 AAGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776377 20:61656355-61656377 AAGTGGGCAGGCGCGTGCTGGGG + Intronic
1175787721 20:61722633-61722655 CACTGTGCATGCGTGGGGGGTGG - Intronic
1175872600 20:62215582-62215604 CGGTGTGCAGGTGTGTGCAGGGG + Exonic
1176090059 20:63314754-63314776 CTGGGGGCATGCGTGTCCTGGGG - Intronic
1179394478 21:41025322-41025344 GAATGTGCATGCATGTGGTGAGG - Intergenic
1179434260 21:41349583-41349605 CAGTCTGCCTCCTTGTGCTGTGG + Intronic
1180314017 22:11262044-11262066 CAGTGTGTATGCGTGGGTTGCGG + Intergenic
1182419380 22:30241535-30241557 CAGTGTGCAGGCAGGTCCTGAGG - Exonic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183387181 22:37521501-37521523 GAGTGTGCAAGCGTGTGATTAGG + Intergenic
1184288469 22:43485661-43485683 TAGTGTGCACACGTGTGTTGAGG - Intronic
1184457172 22:44617226-44617248 CTGTGTGTACGCGTGTGGTGTGG - Intergenic
1185010304 22:48309185-48309207 CAGTGTGGATTCCTGGGCTGGGG - Intergenic
1185260831 22:49861947-49861969 CAGGGTGCAGGCCTGTGCGGGGG - Intronic
952392555 3:32892847-32892869 GGGTGGACATGCGTGTGCTGAGG + Exonic
953548980 3:43885884-43885906 GAGTGTGCGTGCGTGTGGGGTGG - Intergenic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
954682272 3:52352140-52352162 AACTGTGCGTGCGTGTGGTGGGG - Intronic
955717670 3:61847491-61847513 CTGAGTGCATGAGTGTCCTGGGG - Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
958166143 3:89880290-89880312 GTGTGTGTGTGCGTGTGCTGTGG + Intergenic
960052903 3:113254624-113254646 GGGTGTGCATGCGTGTGCACCGG - Intronic
961793740 3:129394619-129394641 CAGTGTGTGTGTGTGTGCAGGGG - Intergenic
962351645 3:134660725-134660747 GAGTGTGCAAGCTTGTCCTGTGG + Intronic
962713189 3:138104314-138104336 CACTGTGCAGGCCTGTGGTGAGG + Intronic
965765526 3:172126230-172126252 CTGTGTGCTTGTATGTGCTGAGG + Intronic
965883382 3:173413963-173413985 CAGTGTGGAACCGCGTGCTGGGG - Intronic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967700146 3:192582893-192582915 CAGTGTGCATGTTTGTGTTGAGG - Intronic
968438420 4:608372-608394 GAGTCTGCAAGCGAGTGCTGAGG + Intergenic
968633360 4:1664647-1664669 CAGTGTGATTGCCTGTGTTGAGG - Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
972015529 4:34239037-34239059 CAGTGTGTATGCGTATGTTTGGG + Intergenic
972379413 4:38505195-38505217 CAGTGTAGGTGCGTGTGATGGGG - Intergenic
972971632 4:44583217-44583239 CACTATGTATGCGTGTGGTGGGG - Intergenic
974145619 4:57943812-57943834 CAGTGTGCAAGCGTGTACATGGG - Intergenic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976081463 4:81359649-81359671 TACTGTGAATGCCTGTGCTGGGG + Intergenic
976134726 4:81923367-81923389 CTGTGTGCATGTGTGTGTTTTGG - Intronic
977723650 4:100269114-100269136 CACTGTGCATTCGTGTTGTGGGG + Intergenic
979468129 4:121064722-121064744 AAGTGTGTATGCGTGTGCGTGGG + Intronic
979692768 4:123577595-123577617 CTGTGTGCATGTGTGTGATCTGG + Intergenic
979831905 4:125315086-125315108 GTGTGTGCATGCCTGTGCGGCGG + Intergenic
980074298 4:128278063-128278085 CAGGGTGCATGGGTAGGCTGGGG + Intronic
983469752 4:168141919-168141941 CAGTGCGCATGCGTGGGCCAGGG + Intronic
984501791 4:180566564-180566586 CAGTGTGGCTGAGTGTGCTTGGG + Intergenic
984702664 4:182828168-182828190 CAGCCTGCGTGTGTGTGCTGGGG - Intergenic
984907895 4:184647550-184647572 CACTGTGAATGTGCGTGCTGTGG - Intronic
985154642 4:186973367-186973389 CAGGCGACATGCGTGTGCTGAGG + Intergenic
985656785 5:1136016-1136038 CAATGTGCATCCGTGTCCTCTGG - Intergenic
987794535 5:22609054-22609076 TTGTGTGCATGCATGTGTTGAGG + Intronic
988348492 5:30070238-30070260 CAGGGTGCTAGCGGGTGCTGGGG - Intergenic
988800686 5:34693722-34693744 CTGTTAGCAAGCGTGTGCTGCGG - Intronic
990840706 5:60076856-60076878 CAGTGTGCTAGCAGGTGCTGGGG + Intronic
991449168 5:66733315-66733337 CTCTGTGCATGTGTGTGGTGGGG - Intronic
992409345 5:76489900-76489922 CAGTGTGCATATGTGTGGTGTGG - Intronic
992800143 5:80288551-80288573 CAGTGTCTATGCAGGTGCTGGGG + Intergenic
994399178 5:99257287-99257309 CAGTGGGGATGTGTGTTCTGGGG + Intergenic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
995130773 5:108628092-108628114 CAGTGTGTGTGTGTGTGTTGGGG + Intergenic
996210070 5:120798068-120798090 CAGTGTGTGTGTGTGTGGTGGGG + Intergenic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
999250004 5:150176884-150176906 CTGTTTGCATGTGTGTGTTGGGG + Intronic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999309418 5:150542337-150542359 CAGGGTGCATGAGTGAGCAGAGG + Intronic
999823001 5:155247477-155247499 CAGTGTGGATGTGTGTTCAGAGG + Intergenic
1002432769 5:179212763-179212785 CAGTGGGCAGGTGTGGGCTGAGG + Intronic
1002459237 5:179364616-179364638 CAGAGTGCATGCTTGAGCTAAGG - Intergenic
1002640473 5:180628341-180628363 CGATCTGCAAGCGTGTGCTGCGG - Intronic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003397571 6:5766234-5766256 GAGTGTGCCTGCGTGAGTTGGGG + Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004834110 6:19511553-19511575 CAGAGTGCTTGCCAGTGCTGGGG + Intergenic
1005485765 6:26297825-26297847 GAGTGTGTATGTGTGTGGTGGGG - Intergenic
1006104423 6:31707935-31707957 CAGAGTCCATGCGTCTGCTGGGG - Exonic
1006557037 6:34876051-34876073 CTGTTTACATGCATGTGCTGGGG + Exonic
1007157449 6:39759182-39759204 CAGTGTGCATGTGTTTGTGGGGG + Intergenic
1007540806 6:42642303-42642325 ATGTGTGCATGTGTGTGATGTGG - Intronic
1008677496 6:53835795-53835817 CAGTTTTCATGTGTGTTCTGTGG + Intronic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1011629814 6:89312387-89312409 CTGTGTGCATGCCTTGGCTGGGG + Intronic
1014432960 6:121390767-121390789 CTGTGTGCAGGCCTGTGTTGGGG - Intergenic
1015395358 6:132727914-132727936 TTGTGTGCATGTGTGTGCTCTGG + Intronic
1018576344 6:165264049-165264071 CTGTGTGCAGGCCAGTGCTGGGG - Intergenic
1019630721 7:2047774-2047796 GAGTGTGCATGTGTCTGCAGAGG - Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1022515115 7:30970330-30970352 CAGTGTGCATGGTTGCGATGTGG + Intronic
1023082058 7:36535180-36535202 CTGTGTGCCTGTGTGTGTTGTGG + Intronic
1023177648 7:37448841-37448863 GAGTGTAAGTGCGTGTGCTGGGG - Exonic
1023680900 7:42686046-42686068 CTGTGTGCATGTGTGGGGTGGGG + Intergenic
1026795168 7:73361640-73361662 CAGGGGGCATGCCTATGCTGTGG - Intergenic
1027215796 7:76182920-76182942 CAAAGTGTATTCGTGTGCTGGGG - Intergenic
1028493374 7:91438904-91438926 AAGAGTGCATGTGTGTGTTGTGG - Intergenic
1029297818 7:99555463-99555485 GAGTGTGCATTCGTGTGCTAGGG - Intronic
1031553509 7:123143553-123143575 CAGAGAGCATTCTTGTGCTGTGG - Intronic
1033038363 7:137895981-137896003 CAGTGTGCAGGGCTGGGCTGGGG - Intronic
1034521481 7:151623896-151623918 CAATGCGCATGTGTGTACTGGGG + Intronic
1034706295 7:153148132-153148154 CACTGCCCATGTGTGTGCTGAGG - Intergenic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035331933 7:158102116-158102138 CAGGGTGAAGGCGTGGGCTGAGG - Intronic
1037126504 8:15357843-15357865 CACTGTGCATGCGTTTACCGTGG - Intergenic
1037423593 8:18730264-18730286 CAGTGTTGATGATTGTGCTGTGG - Intronic
1037806180 8:22058955-22058977 TGCTGTGCATGCGTGTGATGTGG - Intronic
1039980500 8:42406068-42406090 CAGTGAACATGGTTGTGCTGGGG + Intergenic
1040829902 8:51664834-51664856 CAGTGTGCCTGGGAGGGCTGGGG - Intronic
1041456896 8:58070598-58070620 AAGAGTGCATGTGTGTGCTTGGG + Intronic
1042502992 8:69529770-69529792 CAGTTTCCATGCATGTGGTGAGG - Intronic
1043104495 8:76090484-76090506 CAGTGGGCATGTGTGTTCAGAGG + Intergenic
1043172690 8:76985454-76985476 CTGTGTGTATGTGTGTGATGAGG - Intronic
1043370074 8:79581091-79581113 GAGTGCGCATGCTTCTGCTGTGG + Intergenic
1046046531 8:108972329-108972351 CAGGGTGCATGCATGTGCAAGGG + Intergenic
1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG + Intronic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048985144 8:139731075-139731097 CAGTGTGCACGTGTGTGCCCTGG - Exonic
1049700634 8:144010061-144010083 CAGGGTGGATGTATGTGCTGGGG - Intronic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053286893 9:36855546-36855568 TTGTGTGCATGCGTGAGGTGGGG + Intronic
1053429800 9:38034594-38034616 CAGGATGCAGGCGTGTTCTGTGG - Intronic
1053429900 9:38035158-38035180 CAGGATGCAGGCGTGTTCTGTGG + Intronic
1053537024 9:38936199-38936221 CAGTGTGGGTGCGTGTGTGGGGG + Intergenic
1054456275 9:65432053-65432075 CTGTGTGCATGTGTGTGGGGGGG - Intergenic
1054629112 9:67427731-67427753 CAGTGTGGGTGCGTGTGTGGGGG - Intergenic
1055029453 9:71758845-71758867 CAGTGTGAAGGCATGTCCTGTGG - Intronic
1055315317 9:75028430-75028452 CAATGCGCATGCGTGTGCCTTGG + Intergenic
1058464796 9:105216525-105216547 CAGGGTGTGTGCCTGTGCTGTGG - Intergenic
1059362458 9:113755688-113755710 CAGTTTACATGCCTGGGCTGCGG - Intergenic
1059419957 9:114184665-114184687 CACTGTTCATGCGTTTGATGTGG + Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061518104 9:131101289-131101311 CACTGTGCATCTGTCTGCTGGGG - Intronic
1061893909 9:133637089-133637111 CAGTGGGCATGTGTGCTCTGGGG - Intronic
1062195313 9:135269911-135269933 ATGTGGGCATGTGTGTGCTGTGG - Intergenic
1203791115 EBV:152089-152111 CCGTGTGCATGCCTTTGGTGGGG + Intergenic
1203362327 Un_KI270442v1:228163-228185 CAGTGTGTATGCGTGGGTTGCGG + Intergenic
1185776515 X:2807211-2807233 ATGTGTGCATGCTTGTGCTTGGG + Intronic
1186618287 X:11212944-11212966 CAGTGTGCATGCAGGTAGTGGGG + Intronic
1188852756 X:35151394-35151416 CAGGGTGCTAGTGTGTGCTGGGG - Intergenic
1191258778 X:58291488-58291510 CAGTGTGCATGTCTCTCCTGTGG + Intergenic
1192633968 X:72801253-72801275 CAGTGGGCATGCCAATGCTGAGG - Intronic
1192647742 X:72919548-72919570 CAGTGGGCATGCCAATGCTGAGG + Intronic
1195083019 X:101388349-101388371 CAGTATGGATGAGTGTGCTAGGG - Intronic
1195281804 X:103342866-103342888 CAAGGTGTATGCATGTGCTGAGG + Intergenic
1196041627 X:111211146-111211168 CAGTGTGTATGTGTGTGGCGGGG + Intronic
1197617813 X:128714604-128714626 CAGTGTCTATGCAGGTGCTGGGG + Intergenic
1198530764 X:137548382-137548404 CTGTGCGCAGGGGTGTGCTGAGG + Intergenic
1199911235 X:152289270-152289292 AAATGTGCATGATTGTGCTGGGG - Intronic