ID: 1003038817

View in Genome Browser
Species Human (GRCh38)
Location 6:2668763-2668785
Sequence ATTTATTTTTTTAAGTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5381
Summary {0: 1, 1: 1, 2: 25, 3: 461, 4: 4893}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003038816_1003038817 13 Left 1003038816 6:2668727-2668749 CCAGAGTTAAAATCTTATGTTAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1003038817 6:2668763-2668785 ATTTATTTTTTTAAGTAAGAAGG 0: 1
1: 1
2: 25
3: 461
4: 4893
1003038815_1003038817 14 Left 1003038815 6:2668726-2668748 CCCAGAGTTAAAATCTTATGTTA 0: 1
1: 0
2: 2
3: 30
4: 361
Right 1003038817 6:2668763-2668785 ATTTATTTTTTTAAGTAAGAAGG 0: 1
1: 1
2: 25
3: 461
4: 4893

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003038817 Original CRISPR ATTTATTTTTTTAAGTAAGA AGG Intronic
Too many off-targets to display for this crispr