ID: 1003041720

View in Genome Browser
Species Human (GRCh38)
Location 6:2694232-2694254
Sequence GTCCCTGCAGAGGGAAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003041720 Original CRISPR GTCCCTGCAGAGGGAAAAGT AGG (reversed) Intronic
901198499 1:7453611-7453633 GTCCCTGGAGGGGGACATGTGGG + Intronic
902216047 1:14935121-14935143 GTCCCTGCAGAGGGAAAACCAGG - Intronic
902375017 1:16026517-16026539 GGCCCTGCAGAGGGAAGGGTGGG - Exonic
902379989 1:16048324-16048346 GGCCCTGCAGAGAGAAGGGTGGG - Exonic
902505463 1:16936907-16936929 GTCCCTGCAGAAGGTAAAACTGG + Intronic
903154446 1:21434574-21434596 GTCCCTGCAGAAGGTAAAACTGG + Intergenic
903304405 1:22402495-22402517 GCCCCTGGAGAGGGATCAGTGGG + Intergenic
903749163 1:25609417-25609439 GTCCCTGAAGAGGCAAGACTTGG + Intergenic
904459772 1:30669340-30669362 CTTCCTGCAGAGGGAACAGCTGG - Intergenic
904629940 1:31833519-31833541 TTCCCTGCAGAAGGGAAAGTGGG - Intergenic
905017951 1:34790629-34790651 CTCCATGCAGAGGGAACAGCAGG + Intronic
905254318 1:36670302-36670324 TTCCAGGCAGAGGGAACAGTTGG + Intergenic
905556817 1:38892315-38892337 TTGTCTGCAGAGGGAAAACTTGG - Intronic
905561032 1:38927456-38927478 GGCCTTGCAGAGGAAAAGGTTGG - Intronic
906119404 1:43378573-43378595 TTCCATGCAGAGGGAACAGTGGG + Intergenic
906208297 1:43998550-43998572 GGCCCTGCAGAAGGAAATGGAGG - Intronic
907048087 1:51312192-51312214 GTGCCTGAAGAGGAAAAAGAGGG + Exonic
907267962 1:53274299-53274321 GACCCAGCAGAGGGAGAAGTGGG - Intronic
907355852 1:53873356-53873378 GTCCGTGAAGAGGGAATAGCAGG + Intronic
907431594 1:54415269-54415291 GTCCATGCAGAGGGCAAGGCTGG + Intergenic
907930805 1:58998095-58998117 GACCCTGCATATGGAAGAGTGGG + Intergenic
908071943 1:60470203-60470225 TTCCCTGCCAAGGGAAAAATAGG + Intergenic
910166174 1:84329613-84329635 GTGCCTGCACAGGGAAAAGGAGG - Intronic
912799679 1:112713028-112713050 GTCCCTGGTGGAGGAAAAGTTGG + Exonic
912826116 1:112905059-112905081 GTTGGTGCAGAGGGAAAAGAAGG + Intergenic
914839034 1:151232546-151232568 CTCACTGCAGAGGGAATACTGGG - Exonic
914861480 1:151389889-151389911 GTCCCTGGAAAGGGAAATGGTGG - Intergenic
915895983 1:159811322-159811344 GCCCCTGCAGAGGAGGAAGTGGG - Intronic
915964187 1:160292195-160292217 CTTCCTGGAAAGGGAAAAGTAGG + Exonic
917243345 1:172973430-172973452 GTACCTGCTGAGGGAAGAGAAGG + Intergenic
917312842 1:173694713-173694735 GACCCTGAAGGGGGAAGAGTGGG - Intergenic
917530512 1:175830878-175830900 GCCCCTCCAGAAGGAAAAGCTGG - Intergenic
917654516 1:177112877-177112899 GTCATTGCAGAGGGAGAAGCGGG - Intronic
918047936 1:180952665-180952687 GCAGCTGCAGTGGGAAAAGTGGG - Intergenic
918772580 1:188581193-188581215 ATCACTTCAGAGAGAAAAGTGGG - Intergenic
918881110 1:190122556-190122578 GAACCTTCAGAGGGTAAAGTGGG + Intronic
919142346 1:193588599-193588621 TTCCCTGCAGAGGGAAAGGAGGG - Intergenic
920034412 1:203056562-203056584 GTCCCTGCAGAGGCAGAGGAAGG - Intronic
921108415 1:212008256-212008278 GACCCTGCAGAGAGGAAAGCAGG - Intronic
922668231 1:227490672-227490694 GTAGCTGCAGAGGGAAGAGGAGG - Intergenic
923322697 1:232851369-232851391 GTCACTGGAGAGGGAACAATGGG - Intergenic
924899012 1:248374204-248374226 GTCCTTGCAGTGGGAACAATTGG + Intergenic
1065242101 10:23716582-23716604 GAGCCTCCAGAGGGAGAAGTTGG - Intronic
1066306368 10:34146784-34146806 GAGCATGCAGTGGGAAAAGTGGG - Intronic
1069787016 10:70995001-70995023 GTCCCTTCAGAGGCAAATGAGGG - Intergenic
1070615005 10:77962753-77962775 GGCCCTGTAAAGGGAATAGTTGG + Intergenic
1070853365 10:79585318-79585340 GTCCAGGCAGAGGGAACAGCAGG - Intergenic
1071298244 10:84237852-84237874 ACCTCTGCAAAGGGAAAAGTAGG - Intronic
1073921628 10:108466245-108466267 GCCCCCGCGGTGGGAAAAGTGGG - Intergenic
1074509718 10:114101227-114101249 GGCTCTGCGGAGGGAAAAGCCGG - Intergenic
1076178774 10:128389413-128389435 CTCCCGGCAGAGGGAAGAGAAGG + Intergenic
1076418596 10:130311066-130311088 TACCCTGCAGAGAGGAAAGTTGG - Intergenic
1076675714 10:132146543-132146565 GTCCCTGCCCATGGACAAGTGGG - Intronic
1077236624 11:1484951-1484973 GCCTCTGCAGAGGGCACAGTAGG - Intronic
1078330307 11:10413875-10413897 GTCCCTGGAGAGGGGGATGTGGG + Intronic
1079090339 11:17476362-17476384 GGCCCTGCAGAAGCAAAACTTGG + Intronic
1079136645 11:17779330-17779352 GTCCCTGAGGACGGAAAAGCGGG - Intronic
1079608444 11:22399729-22399751 GACCCTGCAGAGGGAAACTGAGG + Intergenic
1080102967 11:28481374-28481396 GTCCCTGCAGAAGGACAAGAAGG - Intergenic
1081684223 11:45030239-45030261 ATCCCAGCAGAGGGAACAGGTGG - Intergenic
1083638122 11:64131167-64131189 GGCACTGCAGAGGGAAATGGGGG + Intronic
1086333504 11:85777228-85777250 GTTACTGCCAAGGGAAAAGTAGG - Intronic
1087783286 11:102324840-102324862 GTTACTGAAGAAGGAAAAGTAGG - Exonic
1089279492 11:117363347-117363369 GGGTGTGCAGAGGGAAAAGTGGG - Intronic
1091204301 11:133809114-133809136 GTGGCTGGAGAGGGAAAAGCTGG - Intergenic
1091900644 12:4141352-4141374 GTCCCTGGAGAAGGAAAACCGGG + Intergenic
1092346044 12:7715367-7715389 GTCTGTGCAGAGAGAAAAGATGG + Exonic
1093957295 12:25235782-25235804 GTCCCTGATGCCGGAAAAGTTGG - Intronic
1096596711 12:52700487-52700509 TTCCATGCAGAGGGAATGGTAGG + Intronic
1097816026 12:64074539-64074561 TTCCAGGCAGAGGAAAAAGTGGG - Intronic
1098146426 12:67502403-67502425 GTCACTGCAGACAGAAAGGTTGG + Intergenic
1098230474 12:68367909-68367931 ATCCCAGCAGAGGTAAATGTAGG + Intergenic
1098563505 12:71904423-71904445 GAGCTAGCAGAGGGAAAAGTAGG + Intronic
1100274090 12:93055609-93055631 GTCCCAGCAGAGGGGATAGATGG - Intergenic
1102549163 12:113678651-113678673 GGCCCGGCAGAGGGCAAGGTTGG + Intergenic
1102877161 12:116457671-116457693 GTCCAGGCAGTGGGAAAGGTAGG - Intergenic
1102997893 12:117363489-117363511 GTGCCTGCAGAAGGCAGAGTTGG + Intronic
1104121801 12:125806870-125806892 GTACCTTCAGAGAAAAAAGTGGG + Intergenic
1104262498 12:127197313-127197335 GTGCCTGCTGAGGGCAAAATGGG + Intergenic
1106017711 13:25884911-25884933 TTCCCTGCAGAGTCAACAGTCGG - Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106362406 13:29044526-29044548 GTCCCTGAAGAGGAAGAATTAGG - Intronic
1107391609 13:39970597-39970619 ATCCCTACACAGGGAAAAATAGG - Intergenic
1108610118 13:52077118-52077140 TTCCATGCAGAGGGAACAGTGGG + Intronic
1109547418 13:63846697-63846719 GTCTTATCAGAGGGAAAAGTGGG + Intergenic
1110774654 13:79394136-79394158 GTGCCAGCAGAGGGGAAGGTTGG - Intronic
1112282858 13:98077775-98077797 GTACCTGCAGAGTGAAAAATTGG - Intergenic
1112879914 13:104094334-104094356 TTCCCAGCAGAGGGAATGGTTGG - Intergenic
1113398199 13:109968455-109968477 GTCACTGAAGAGTCAAAAGTAGG + Intergenic
1115739353 14:36371680-36371702 GTCTGTGCAGAGAGAAAAGATGG + Intergenic
1116356424 14:43936874-43936896 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1116696418 14:48183463-48183485 GTCAGTGCAGAGGGGAAATTTGG + Intergenic
1117075923 14:52104153-52104175 GTCCTTTCAAAGGGCAAAGTTGG + Intergenic
1121087241 14:91155937-91155959 GTGCCCTCAGAGGGGAAAGTGGG - Intronic
1123936660 15:25197322-25197344 GTGCCTCCATAGGGCAAAGTGGG - Intergenic
1124944487 15:34251054-34251076 TTCTCTGCAGTGGGAAAAATGGG + Exonic
1124997189 15:34735343-34735365 TTCCAGGCAGAGGGAATAGTTGG - Intergenic
1126177088 15:45745808-45745830 GTCCCGGCAGAGGAAACAGCAGG + Intergenic
1127679875 15:61283125-61283147 GAACCAGTAGAGGGAAAAGTGGG + Intergenic
1127877990 15:63128348-63128370 GCACTTACAGAGGGAAAAGTGGG + Intronic
1128691173 15:69726017-69726039 GTCCCTGCAGAGGGGCTGGTTGG - Intergenic
1128916112 15:71564140-71564162 CTTCCTGAAGAGGGAAAAATGGG - Intronic
1129979538 15:79854903-79854925 GTTGCTGCAGACTGAAAAGTGGG + Intronic
1130245243 15:82241551-82241573 GTCCCATCAGTGGGAAAAGTTGG - Intronic
1130455439 15:84101861-84101883 GTCCCATCAGTGGGAAAAGTTGG + Intergenic
1130819045 15:87473336-87473358 GTCTCTGCTGTGGGAAGAGTGGG - Intergenic
1131412231 15:92219283-92219305 TGCCCAGCAGAAGGAAAAGTAGG + Intergenic
1132980829 16:2738007-2738029 ATCCCTACAGAGGGCAGAGTGGG - Intergenic
1132981909 16:2742623-2742645 GTCCCTGCAAAGGGCAGAGTGGG - Intergenic
1133008733 16:2898483-2898505 GTCCCTGCAGAGGGCAGAGGGGG + Intronic
1135355318 16:21764143-21764165 GCCCCTCAAGAGGCAAAAGTGGG - Intergenic
1135453804 16:22580285-22580307 GCCCCTCAAGAGGCAAAAGTGGG - Intergenic
1135623647 16:23976865-23976887 GTTACTGCAGAGGGAAGGGTAGG + Intronic
1137444001 16:48520960-48520982 GTCCCTGCAGAGGGGACAACAGG + Intergenic
1137690397 16:50422892-50422914 GGCCCTGCAGAGGGCAAATTAGG + Intergenic
1138093273 16:54193789-54193811 GGCACTGCAGAGGGAAAGGCCGG - Intergenic
1138891481 16:61149440-61149462 GTCCCTGCCTAGTGAAAAGCAGG + Intergenic
1139653102 16:68372384-68372406 GACCCTGCAGAGACAAAAGTAGG + Exonic
1140750394 16:78018241-78018263 TTCCCTGAAGAGGGATAAGCTGG + Intergenic
1141054972 16:80805187-80805209 GTCCCTGGACAGGCAAAACTGGG + Intergenic
1141610167 16:85176759-85176781 GTCCCTGCAGAGAAGAAAGGTGG - Intronic
1141658634 16:85429710-85429732 TTCCAGGCAGAGGGAACAGTGGG - Intergenic
1142923002 17:3207583-3207605 GTCACAGCATAGAGAAAAGTGGG - Intergenic
1143074377 17:4327945-4327967 GTTCCTGCAGAAGGAAGAGAAGG - Intronic
1144315367 17:14055784-14055806 TTGCCTGCATAGGGAAAAGGGGG + Intergenic
1144970888 17:19108859-19108881 GGCTCTGCATATGGAAAAGTGGG + Intergenic
1144991190 17:19235021-19235043 GGCTCTGCATATGGAAAAGTGGG + Intronic
1146074568 17:29716132-29716154 GTCACTGGAGAGAGAAAACTAGG - Intronic
1146399937 17:32494381-32494403 GACCCTGCAGAGGGAAGGGGTGG - Exonic
1146585809 17:34080582-34080604 GTACCTGCAGAGGGAAGGATGGG + Intronic
1146874071 17:36394001-36394023 GTCCCAGCCCAGGGAAAAGGTGG - Intronic
1148441556 17:47714187-47714209 GTCCTTGCAGAGGGAGAGATGGG - Intergenic
1148713701 17:49700369-49700391 GTGGCAGCAGAGGGAAAAGGCGG - Intergenic
1148796388 17:50199324-50199346 GTCCCTGCAGGGGGAGAGGGCGG + Exonic
1149204802 17:54231304-54231326 GTCCGTGCAGAAGGAAAAAGTGG - Intergenic
1150029497 17:61717906-61717928 GACACTGCAGAAGGAAAATTTGG - Intronic
1150316563 17:64174272-64174294 GTCCCTGCAAAGGCAAAGGAAGG + Intronic
1151563940 17:74886730-74886752 GACCCTGGAGAGGGGAAAGGGGG - Intronic
1151680543 17:75620539-75620561 CTCCTTGGAGAAGGAAAAGTCGG - Intergenic
1151752715 17:76050027-76050049 GGCCCTGCAAAGGGAGAAGAAGG + Intronic
1151758020 17:76085794-76085816 TTACCTGCACAGGGAAAAATGGG + Exonic
1152004724 17:77673035-77673057 GTCCCTGGTGAGAGAAAAGGAGG - Intergenic
1152068882 17:78125564-78125586 GTCCCTGCAGAGGGACGGGGGGG + Intronic
1152230574 17:79112277-79112299 GACCCTGCAGAGAGAAACATGGG - Intronic
1153799320 18:8655686-8655708 GTCTCTGCAAAGGAAAAAGAGGG + Intergenic
1157331082 18:46704441-46704463 GTTCCTATAGAGCGAAAAGTAGG - Intronic
1157413928 18:47486368-47486390 GTCCCTGCAGAGGAAACAAGGGG - Intergenic
1158551821 18:58442594-58442616 GTCCCTGCACATGGCAAATTAGG + Intergenic
1158888064 18:61847812-61847834 TTCCAAGCAGAGGGAAGAGTAGG - Intronic
1159651750 18:70986415-70986437 GGCAATGCAGAGGGAAATGTAGG + Intergenic
1161681514 19:5681985-5682007 GTCCCTGGAAGGGGAAAAGGTGG + Intronic
1162898447 19:13779408-13779430 GTCACAGCACAGGGAAAAGTTGG + Intergenic
1163148462 19:15397976-15397998 GTCCCAGCAGAGGGACAGGCTGG + Intronic
1163617767 19:18340054-18340076 GTTCCGGCAGAGGGAACAGCAGG + Intergenic
1164482071 19:28619496-28619518 GTTCCTGGAGAGGGTGAAGTTGG + Intergenic
1165701569 19:37942447-37942469 TTCCCAGCAGAGGGAACAGCAGG + Intronic
1166496560 19:43307042-43307064 GTCCAGGCAGAGAGGAAAGTAGG - Intergenic
1167850008 19:52194250-52194272 GTCTGGGCAGAGGGAATAGTTGG + Intronic
925112738 2:1350229-1350251 GACTCTGCAGAGGGAGAAGGTGG + Intronic
925185102 2:1841855-1841877 GTGCCTGCAGACGGGAGAGTGGG + Intronic
926121813 2:10245348-10245370 GTGGCTGCAGAGGGAAGAGAAGG + Intergenic
926742497 2:16124498-16124520 GTCCTTGCAGTGGGAGAAGAAGG + Intergenic
927127737 2:20028228-20028250 GTCCCTGCTAAGGAACAAGTTGG - Intergenic
927226982 2:20776858-20776880 GTCCCAACAGAAGGAAAACTTGG - Intronic
927829371 2:26335761-26335783 GTAACTGCAGAGGGGAAAGCAGG - Intronic
929820363 2:45268712-45268734 GTCCTTCCAGTGGAAAAAGTGGG + Intergenic
929861324 2:45680354-45680376 CACCCTGCAGAGGGGAAAGAAGG - Intronic
930053514 2:47235028-47235050 GTCCCTGCAGAGAGGAAGGGAGG + Intergenic
931001998 2:57794925-57794947 GTCCTTGCAGAGGGAGGAGGTGG + Intergenic
931231686 2:60380445-60380467 GTGGCTGCTGAGGGAGAAGTGGG - Intergenic
931691987 2:64841818-64841840 GCCCCTGCAGACCCAAAAGTAGG + Intergenic
932082799 2:68730947-68730969 GTGCATGCACAGGGTAAAGTGGG - Intronic
933937832 2:87220627-87220649 GTCCATTCAGAGGGTAGAGTTGG - Intergenic
936355306 2:111745145-111745167 GTCCATTCAGAGGGTAGAGTTGG + Intergenic
937302056 2:120848584-120848606 GACCCTGGGGAGGGAAGAGTTGG + Intronic
940425209 2:153524371-153524393 GTCCTTGCAGGGGGAATAATTGG - Intergenic
940717972 2:157249369-157249391 GTCTATGCAGAGGTAAAAGCAGG - Intergenic
942655378 2:178209531-178209553 CTCCCTGCACAGGGAAACCTCGG + Intronic
942866321 2:180679819-180679841 GATCCTGCAGAGGGAACAGCTGG - Intergenic
945109541 2:206349246-206349268 GGCAATGCAGAGGGAAATGTGGG - Intergenic
945533339 2:210983184-210983206 GGCCATCCAGAGAGAAAAGTCGG - Intergenic
946864065 2:224027085-224027107 CTCTCTGCAGAGGGAAATGTTGG - Intronic
948128974 2:235586292-235586314 GAGCGTGCAGAGGGCAAAGTGGG - Intronic
1168887947 20:1273191-1273213 GTCCCTGCAGAGGAAAAGTTGGG + Intronic
1169111671 20:3038040-3038062 GTTCCTGGAGAGTGAAAGGTAGG - Exonic
1170575119 20:17656704-17656726 GTCCCATCTGAGGGAAAAATAGG - Intronic
1171134204 20:22682541-22682563 ATCTCTGCACAGGGCAAAGTCGG + Intergenic
1172101683 20:32487519-32487541 TTCCAGGCAGAGGGAATAGTTGG + Intronic
1172397098 20:34615964-34615986 GTCCCTGCTGGGGGAAAGGAAGG - Intronic
1172488908 20:35318353-35318375 TGCCCTGCAGATGGTAAAGTAGG - Intronic
1174079769 20:47962635-47962657 CTCCCAGCAGAGGGAGAAGCTGG - Intergenic
1174165978 20:48583902-48583924 CTCCGGGCAGAGGGAAAAGCAGG + Intergenic
1174651032 20:52125714-52125736 GTCTCTGCACAGGGAGAGGTTGG + Intronic
1175603440 20:60293675-60293697 CTATTTGCAGAGGGAAAAGTGGG + Intergenic
1175626052 20:60489076-60489098 GTGCTTGCAGAGGGACATGTTGG + Intergenic
1175684484 20:61017671-61017693 GTCCCTGAAGGAGGAAACGTGGG - Intergenic
1175901727 20:62362549-62362571 GGCCCTGCAGAGGGAACGGGAGG + Exonic
1176969820 21:15252627-15252649 ATCCCTGCAGAAGGGGAAGTGGG + Intergenic
1178083210 21:29087130-29087152 GTCCAGGCAGAAGGAAAAGCTGG - Intronic
1178582020 21:33845665-33845687 GTGCTTGCAGAGGGGAAACTGGG + Intronic
1179681816 21:43027445-43027467 GTCACTGCAGGAGGAAAAGCTGG + Intronic
1181118634 22:20650384-20650406 GTCTCTGCAGAGGGACAACATGG - Intergenic
1183109259 22:35637047-35637069 GTCCCAGCAAAGGGCAGAGTTGG + Intronic
1183279198 22:36923115-36923137 GTCCCTGCAGAGGCACCAGGTGG - Intronic
1184186334 22:42867684-42867706 GTCCCTGCAGATGGAGAACAGGG - Intronic
1184504227 22:44891348-44891370 GTCCCTGCAGAGGAAACGGCTGG - Exonic
1185281009 22:49969882-49969904 TTCCCTCCTGAGTGAAAAGTGGG - Intergenic
949605486 3:5648167-5648189 GTCCCCTCAGAGGGAGAAGAAGG + Intergenic
950234820 3:11309605-11309627 GGCCTTGGTGAGGGAAAAGTAGG + Intronic
950427779 3:12933964-12933986 GTCCCTGCAGAGTGGACAGGTGG - Intronic
950670891 3:14524763-14524785 ACCCCTGCAGAAGGAAAAGCAGG - Intronic
950842103 3:15977657-15977679 GTCAGAGCAGAGGGAAAAGGAGG - Intergenic
951461068 3:22952554-22952576 GTCATGGCAGAGGGAAAAGTGGG + Intergenic
951948962 3:28177043-28177065 GTCCCAGAAGAGAGAAAAGTAGG + Intergenic
952252325 3:31666464-31666486 TTCCCTGCAGAGGCAAAGGAGGG - Intronic
953170788 3:40505679-40505701 TGCGCTGCAGTGGGAAAAGTGGG - Intergenic
953618369 3:44511761-44511783 GTCCCTGTAGAGGGAGAGTTGGG + Intergenic
954050297 3:47970001-47970023 GTCACTGCTGTGGGCAAAGTGGG - Intronic
954984590 3:54778405-54778427 CTTCCTGCAGAGAGAAAAGCAGG - Intronic
955447274 3:59026723-59026745 GTCACTGAAGAAGGAAAGGTAGG + Intronic
955812272 3:62803894-62803916 GGCCCCACGGAGGGAAAAGTGGG - Intronic
960224955 3:115158040-115158062 GGCAGTGCAGAGGGAAATGTAGG + Intergenic
960274345 3:115710715-115710737 GTCCCTTCACAGTGAAAACTGGG + Intronic
960275114 3:115720266-115720288 GTCCCTAGAGAGGGCAGAGTTGG - Intronic
960513256 3:118575565-118575587 GTCCCAGCTGAGGGGAAAATTGG + Intergenic
962741999 3:138368736-138368758 GTCACCGCAGAATGAAAAGTTGG - Intronic
964816838 3:160726902-160726924 GTCCAGGCAGAGGGAATAGCAGG - Intergenic
965455550 3:168895342-168895364 GTCCCAGAAGAGGAAAAAGAGGG + Intergenic
965672243 3:171158877-171158899 TTCCAGGCAGAGGGAAAAGCAGG + Intronic
965979975 3:174677121-174677143 GTCACTGCAGAGCCAAAAGGCGG - Intronic
967891931 3:194369788-194369810 GTCACTGCAGAGGGCAGTGTTGG + Intergenic
968092556 3:195908214-195908236 GTCTGTGCAGAGGGAAGAGAGGG - Intronic
969198264 4:5580626-5580648 GAGCCTGCAGAGGGAAGAGCAGG - Intronic
971197271 4:24481405-24481427 CTCCAGGCAGAGGGAAGAGTAGG - Intergenic
975633290 4:76422725-76422747 GACCTTGGAGAGGGAAAAGGAGG - Intergenic
976426191 4:84905826-84905848 GACCCTGCAGTGTGAACAGTTGG - Intronic
979878674 4:125927631-125927653 GTCCTTGCAGGGGGAATAATTGG - Intergenic
981359938 4:143834689-143834711 TTCTCCCCAGAGGGAAAAGTGGG - Intergenic
981370710 4:143955765-143955787 TTCTCCCCAGAGGGAAAAGTGGG - Intergenic
983655675 4:170081208-170081230 GACCCAGCAGAAGGAAAAATAGG + Intronic
985782901 5:1880352-1880374 GCCCCTACAGTGGGAACAGTGGG - Intronic
985848492 5:2371593-2371615 GTCTCTGCCGAGGTGAAAGTGGG - Intergenic
986407143 5:7437342-7437364 GCCCCTGCAGGAGGAAAAATTGG + Intronic
986817531 5:11429075-11429097 TTCCCTACAGAGGAATAAGTTGG - Intronic
987381355 5:17288848-17288870 GTCCAGGCAGAGGGAACAGCTGG + Intergenic
988107881 5:26773467-26773489 GTCTCTGCTGATGGAAAATTGGG - Intergenic
988869726 5:35375868-35375890 GTCTACGCAGAAGGAAAAGTAGG + Intergenic
989833481 5:45951689-45951711 GTATCTGCAGAGGGAAAGTTGGG + Intergenic
990515951 5:56530975-56530997 TTTCCAGCAGAGGGAAAAGCAGG - Intronic
991277928 5:64872871-64872893 GACCCATCAGAGGGAAATGTGGG - Intronic
991637185 5:68717918-68717940 GTCCTTCCAGAGAGAAAGGTTGG - Intergenic
991736251 5:69632957-69632979 GTCCCGGGAGTGGGAAGAGTTGG - Intergenic
991758816 5:69902186-69902208 GTCCCGGGAGTGGGAAGAGTTGG + Intergenic
991812747 5:70488596-70488618 GTCCCGGGAGTGGGAAGAGTTGG - Intergenic
991815706 5:70509073-70509095 GTCCCGGGAGTGGGAAGAGTTGG - Intergenic
991838045 5:70777252-70777274 GTCCCGGGAGTGGGAAGAGTTGG + Intergenic
992027102 5:72681294-72681316 GGCCCTGCAAGGGTAAAAGTTGG + Intergenic
993827671 5:92712170-92712192 ATCCCTGCAGAGGGGACAATGGG - Intergenic
994486645 5:100390995-100391017 GTCCCGGGAGTGGGAAAAGGTGG - Intergenic
995124417 5:108565896-108565918 ATCCCTGCAGAGTGACTAGTGGG + Intergenic
996610078 5:125368195-125368217 GTCCATGCAGCTGGAAAAGGTGG - Intergenic
997930063 5:138065353-138065375 GTCTGAGCAGAGGAAAAAGTTGG - Intergenic
999328505 5:150657768-150657790 TTCCCTCCAGAGGGGATAGTGGG - Intronic
999329860 5:150665673-150665695 GCACTTGCAGAGGGCAAAGTGGG - Intronic
1000374200 5:160564375-160564397 GTCACTTCACAGGGAAAAGAAGG - Exonic
1000684977 5:164237466-164237488 TTCCCTGCAGGGAGATAAGTTGG + Intergenic
1001241034 5:170070013-170070035 CTCCCTGCAGAAGCAACAGTCGG + Intronic
1001880436 5:175239253-175239275 TTCCCAGCAGAGGGAACAGCAGG - Intergenic
1003041720 6:2694232-2694254 GTCCCTGCAGAGGGAAAAGTAGG - Intronic
1003720906 6:8701055-8701077 TTCCAGGCAGAGGGAAGAGTGGG - Intergenic
1004819580 6:19352717-19352739 GTTTCTTCAGAGGGATAAGTAGG + Intergenic
1005695285 6:28346119-28346141 GTCCCTGTAAATGGAAAGGTAGG + Intronic
1006175596 6:32119590-32119612 GTCACTGCAGATGGAGAAATGGG - Intronic
1006797478 6:36741053-36741075 GCCCCTGCTGTGGGAAAGGTGGG - Exonic
1007394926 6:41572179-41572201 GGCCCTGCCGTGGGAAAAGCTGG - Intronic
1008220852 6:48852130-48852152 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1008317647 6:50065901-50065923 GACACAGCAGAGGGAAAACTTGG + Intergenic
1010821723 6:80422392-80422414 GGCAATGCAGAGGGAAAAGGTGG + Intergenic
1011088640 6:83570861-83570883 GGCAGTGCAGAGGGAAATGTGGG + Intronic
1011243368 6:85296348-85296370 ATACCTGCTGAGGGAAAATTAGG + Intergenic
1011348992 6:86401870-86401892 GGCAGTGAAGAGGGAAAAGTGGG - Intergenic
1012682954 6:102206120-102206142 TTCCAGGCAGAGGGAAGAGTGGG - Intergenic
1013596242 6:111663403-111663425 CCCCCTGCAGAGGGAACACTCGG + Intronic
1014407484 6:121069242-121069264 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1014861255 6:126470494-126470516 GGCAATGCAGAGGGGAAAGTGGG + Intergenic
1016714496 6:147208651-147208673 TTCCTTGCAGATTGAAAAGTAGG + Intronic
1017820877 6:158048313-158048335 GCCCTTGCAGAGGGAACAATGGG + Intronic
1017939091 6:159035904-159035926 GTCCGTGCAGAGGAATAAGCGGG - Exonic
1018099691 6:160426460-160426482 GAACCTGCCGAGGGAAGAGTGGG - Intronic
1019266325 7:119356-119378 CTCCCTCCAGTGGGAAGAGTAGG + Intergenic
1019363653 7:619157-619179 GTCCACGCAGAGCGAAGAGTCGG + Intronic
1019398521 7:836806-836828 ACCCCTGCAGAGGGAAAGGATGG + Intronic
1019618895 7:1979978-1980000 GTCCCTGCAGAGAGGAACCTAGG + Intronic
1020283840 7:6664925-6664947 GACCCTGCAGAAGGAAAGGAGGG - Intergenic
1020927579 7:14351441-14351463 GTCAGTGCAGAGGGAAAGGGAGG + Intronic
1023191888 7:37591947-37591969 CTCACTGCAGAAGGAAAAGTAGG + Intergenic
1025639659 7:63354413-63354435 GGCCCTTCAGAGGGAAAGGGCGG - Intergenic
1025643040 7:63393679-63393701 GGCCCTTCAGAGGGAAAGGGCGG + Intergenic
1026215743 7:68347302-68347324 GTGCTTTCAGAGGGCAAAGTGGG - Intergenic
1029699778 7:102238717-102238739 TTCCCAGCAGAGTGAAAAGTGGG - Intronic
1029714760 7:102319876-102319898 GTCCCTGCAGAGCCAAAACCCGG - Intronic
1031354540 7:120775590-120775612 GTCCCTGGAGAGTGAGAAATTGG - Intergenic
1033134440 7:138773228-138773250 GTCCCTGGAGAGGCCAAAGCTGG - Intronic
1034320215 7:150173157-150173179 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1034501998 7:151456671-151456693 GTCCCTGCAGAGAGATTACTAGG - Intergenic
1037585273 8:20271638-20271660 TTCCTGGCAGAGGGAAGAGTAGG - Intronic
1038972717 8:32654948-32654970 GGCCATGAAGAGGGACAAGTAGG - Intronic
1040076159 8:43233478-43233500 GTTCCTACAGAGGAAAAAGCTGG - Intergenic
1040641168 8:49335830-49335852 GACCCTTCAGAGGGTGAAGTGGG - Intergenic
1040880708 8:52201449-52201471 AACCCTGCATAGGGAAATGTTGG - Intronic
1044157340 8:88863779-88863801 GTCCCTACAGAAGGAAGTGTAGG - Intergenic
1046725030 8:117664976-117664998 TTCCCTGGAGAGGGAAGAGTAGG + Intergenic
1047841056 8:128753916-128753938 GTTCCTACAGAGGGAATAATTGG - Intergenic
1048531502 8:135254137-135254159 CTCCCTGGAGAGGTAGAAGTGGG - Intergenic
1049181682 8:141226196-141226218 GTCCAAGCAGAGGGGAAAGATGG - Intronic
1049197944 8:141325698-141325720 GTCTCTGCAGACGGAAAAGATGG + Intergenic
1049905030 9:208731-208753 GGCCCTACAGAGGGGAAAGTTGG - Intergenic
1049962984 9:754223-754245 TTCCATGCAGAGGTAAATGTAGG - Intergenic
1050313250 9:4374316-4374338 ATCCCTGCAAAGGAAAAAGATGG + Intergenic
1050368848 9:4900482-4900504 GTGCAGCCAGAGGGAAAAGTCGG - Intergenic
1051028904 9:12649831-12649853 GCCCCTGCAGAGTTAAGAGTAGG - Intergenic
1051717931 9:20004384-20004406 GCACCTGCAGTGGGAAGAGTGGG + Intergenic
1052383706 9:27800507-27800529 GGCCTTGCAAATGGAAAAGTTGG - Intergenic
1055192806 9:73547079-73547101 GGCATGGCAGAGGGAAAAGTTGG - Intergenic
1055885961 9:81063476-81063498 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1056527123 9:87454108-87454130 ATCACTGCAGAAGGAAAAGAGGG + Intergenic
1056592049 9:87971718-87971740 GTCCCAGCACTGGGAAAGGTGGG - Intronic
1057892496 9:98880046-98880068 GCCCCTGGAGAGGGGAATGTGGG + Intergenic
1059039840 9:110800603-110800625 GTTCCTGGAGAGGCCAAAGTCGG - Exonic
1059374296 9:113870301-113870323 ATCCCCGCACAGGGAGAAGTTGG - Intergenic
1060102828 9:120855886-120855908 GGGCCTGGAGAGGGAAAAGGAGG - Exonic
1060282814 9:122225637-122225659 GACCCTGGAGAGGCCAAAGTCGG + Intronic
1061218371 9:129235052-129235074 GTTCCAGCAGAGGGAACAGCTGG - Intergenic
1061266035 9:129505593-129505615 CTCTCTGCTGAGGGAAAAGACGG + Intergenic
1061356394 9:130108780-130108802 GACACTCCAGAGGGAAAAGAAGG - Intronic
1062290128 9:135790655-135790677 GTCCCTGAGAAGGGAAAAGTCGG - Intronic
1187375274 X:18747115-18747137 GTCCAGGGAGAGGGAAGAGTGGG + Intronic
1188278684 X:28235714-28235736 GTCACTGCAGAGTGAGAATTTGG + Intergenic
1189935997 X:46068352-46068374 GTCCTTGCAGAGGGTATAATTGG + Intergenic
1191941135 X:66482954-66482976 GTCCCTGCTGCTGGAAAATTGGG + Intergenic
1195347086 X:103962000-103962022 GTCTGTGCAGAGAGAAAAGATGG - Intronic
1195360356 X:104076841-104076863 GTCTGTGCAGAGAGAAAAGATGG + Intergenic
1195521532 X:105835761-105835783 GCCACTGCAGTGGGAAAGGTAGG - Intronic
1197341045 X:125266645-125266667 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1197405171 X:126039865-126039887 GTCTCTGCAGCTGGAAAATTGGG - Intergenic
1198253585 X:134905458-134905480 GTCCCTGGAGAGAGAAATGGGGG + Intronic
1199155994 X:144550116-144550138 GTCCTTGCAGAGGGGACAATTGG - Intergenic
1200445477 Y:3256137-3256159 GGCACTGCAAAGGGAAATGTGGG - Intergenic
1200831031 Y:7689146-7689168 TTCTCAGCAGAGGGAAAAGATGG - Intergenic
1201367960 Y:13229079-13229101 GATCCTGCAGAGGAGAAAGTTGG + Intergenic