ID: 1003043808

View in Genome Browser
Species Human (GRCh38)
Location 6:2714336-2714358
Sequence GGGTGAGTTAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 10, 2: 20, 3: 30, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003043808_1003043812 3 Left 1003043808 6:2714336-2714358 CCTCAATTTGCATTAACTCACCC 0: 1
1: 10
2: 20
3: 30
4: 137
Right 1003043812 6:2714362-2714384 AATTTGCATGTAATTGAAAGTGG 0: 22
1: 98
2: 205
3: 271
4: 495
1003043808_1003043813 4 Left 1003043808 6:2714336-2714358 CCTCAATTTGCATTAACTCACCC 0: 1
1: 10
2: 20
3: 30
4: 137
Right 1003043813 6:2714363-2714385 ATTTGCATGTAATTGAAAGTGGG 0: 26
1: 115
2: 189
3: 287
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003043808 Original CRISPR GGGTGAGTTAATGCAAATTG AGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906135875 1:43500615-43500637 GGGTGAATTCATGCTATTTGTGG + Intergenic
906234412 1:44195870-44195892 GGGTGGACTAATGCCAATTGAGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
910375064 1:86559395-86559417 GGCTTAGTTGATGCAAACTGAGG - Intronic
913676474 1:121145782-121145804 AGGTCAGGTAATGAAAATTGGGG - Intergenic
914028370 1:143933732-143933754 AGGTCAGGTAATGAAAATTGGGG - Intergenic
915669505 1:157476997-157477019 GGGGGAGTTAAAGAACATTGTGG + Intergenic
916945458 1:169721794-169721816 GGGTGAATGAATGCATATTTTGG - Intronic
918389784 1:184047251-184047273 GAGTGAGAAAATGTAAATTGAGG - Intergenic
919841991 1:201616181-201616203 GTGTGACCTAAGGCAAATTGCGG - Intergenic
920463840 1:206164623-206164645 AGGTCAGGTAATGAAAATTGGGG - Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923202460 1:231725492-231725514 GGGTGAGCTAGTGCAAATTGAGG - Intronic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
924518027 1:244782268-244782290 GGGTGAGAGAATGCAAACTGAGG - Intergenic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1070122123 10:73588030-73588052 GGGAGAGATAATGCATATAGAGG - Intronic
1070985457 10:80686136-80686158 GGGTGACTTAATGAAAGATGAGG + Intergenic
1072844068 10:98809078-98809100 GAGTGAGTCAATGTCAATTGGGG - Intronic
1072945433 10:99805612-99805634 GGGTGAATAAATAGAAATTGGGG - Intronic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1076330322 10:129659585-129659607 TGATGAGTTAGTGCAAATTGAGG + Intronic
1076681157 10:132172064-132172086 GGATGAGTGAATGCAACGTGGGG - Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1080989467 11:37513306-37513328 GGGTGAGATATATCAAATTGTGG - Intergenic
1083731092 11:64653181-64653203 GGGTGAGTTTCTGCCAAATGGGG - Intronic
1083915721 11:65742395-65742417 GCGTGAGTCAATTCAAATTGAGG + Intergenic
1085185764 11:74574884-74574906 AGGTGACTTAATACAAATTTTGG + Intronic
1088434848 11:109800658-109800680 GAATGAGTTAATGGAATTTGCGG - Intergenic
1088450869 11:109980019-109980041 GGGTGACTAAATGCAGGTTGGGG + Intergenic
1090521031 11:127479620-127479642 GTGTGAGTTAATGGAAAATCTGG - Intergenic
1090681912 11:129068850-129068872 TGATGAGATACTGCAAATTGAGG - Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1094794597 12:33956543-33956565 GGGCTAGTTACTGCAGATTGAGG - Intergenic
1095367353 12:41423458-41423480 GGATGAGTTAATGCCCTTTGCGG - Intronic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG + Intronic
1099428316 12:82551181-82551203 GGGTGAGCTGAAGCAAAGTGGGG - Intergenic
1103528643 12:121584279-121584301 AGGTGAGTTAAAACAAATTCTGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105732998 13:23238125-23238147 CAGTGAGTTAAGGCAATTTGAGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106450406 13:29876677-29876699 GAGTGAGTTAATGAAAAATTGGG + Intergenic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1108438389 13:50424138-50424160 GGGTAATTGAATGCCAATTGAGG + Intronic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1110436855 13:75485210-75485232 GGATGAGGAAATGCAAGTTGTGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1111693444 13:91593145-91593167 GGGTGAGTTAAGGAAATGTGGGG - Intronic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112023869 13:95394860-95394882 GGTTCAGTTAATGAAAATCGAGG + Intergenic
1112392206 13:98995837-98995859 GGCTGAGTTAGTGCAAATTGAGG + Intronic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1118038912 14:61896589-61896611 GAATGAGTTAATGAAAATTCTGG + Intergenic
1120081014 14:80216297-80216319 GAGCCAGTTAATGCTAATTGTGG + Intronic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1123835205 15:24182977-24182999 GGGCAAGTCAAGGCAAATTGAGG + Intergenic
1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1125989111 15:44088297-44088319 GAGAGAGTTAATGGAAAGTGAGG - Intronic
1126874275 15:53022845-53022867 GGGTGATAAAATTCAAATTGAGG - Intergenic
1128320445 15:66690049-66690071 GGGTGAGATAATTCCAAATGAGG - Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1131993072 15:98109192-98109214 GGATGAGTGAATGAAAAGTGGGG + Intergenic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1135861011 16:26056124-26056146 GGGGAAGTTAATTCAAATGGAGG - Intronic
1136771308 16:32844023-32844045 GGGAAAGGTAATGCAAAATGTGG - Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1140300585 16:73753476-73753498 GAGTGGGTTAAAGTAAATTGAGG - Intergenic
1141000213 16:80300707-80300729 GGGTGAGTCAATGCATGTGGTGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142335060 16:89483128-89483150 GGATGAGTGAAGGCAAATGGAGG - Intronic
1203073733 16_KI270728v1_random:1106133-1106155 GGGAAAGGTAATGCAAAATGTGG - Intergenic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1145194301 17:20874984-20875006 TGGTCAGTTTATGTAAATTGTGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1150551620 17:66215973-66215995 GAGTGAGTTCAAGGAAATTGGGG - Intronic
1151638357 17:75369237-75369259 GGGTAAGTTGATGCAAAATGAGG - Intronic
1151905465 17:77045611-77045633 GGGTTGGTTAATGCAGAGTGAGG - Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1157833952 18:50881921-50881943 TGATGAGAAAATGCAAATTGGGG + Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1162475719 19:10898338-10898360 TGGTGAGTTCAGGCCAATTGAGG - Intronic
1166513337 19:43426206-43426228 GTGTGGATTAATGCAAATTAAGG - Intergenic
1168600467 19:57713963-57713985 GGCAGAGTAAATGCATATTGGGG + Intronic
925725005 2:6864072-6864094 CAGTGAGATAATGCACATTGAGG - Intronic
928503648 2:31925534-31925556 GGGTGACTTGATTTAAATTGTGG - Intronic
929457198 2:42074443-42074465 GGGTGAGTTAAACCAATGTGGGG - Intergenic
930544632 2:52750851-52750873 GGGTGAGTTAATGGAGTCTGGGG + Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931202947 2:60118080-60118102 AGATAAGTTACTGCAAATTGAGG + Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933459146 2:82557484-82557506 TGGTGAGTTTATTGAAATTGAGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
937943209 2:127306146-127306168 AAGTGATGTAATGCAAATTGAGG - Exonic
942529134 2:176889494-176889516 GGGAGAGCTAATGGAAATGGAGG + Intergenic
945711881 2:213307113-213307135 TGGTGAGTTGAGGCAAATTTTGG - Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1177355761 21:20004702-20004724 GGATGAGTCAATGCAAATTGAGG - Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178513077 21:33223299-33223321 GGGTGGGTTAATCCGAAGTGGGG + Intergenic
1179509591 21:41863608-41863630 GGGTGACTTCAGGCAAATGGGGG + Intronic
1185242915 22:49755981-49756003 GGATGGGCCAATGCAAATTGAGG - Intergenic
949726756 3:7057041-7057063 GTGTGAATTAATGCAAATATTGG + Intronic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
951703124 3:25516147-25516169 AGGTGGGTTGATGCAATTTGGGG - Intronic
956495607 3:69822717-69822739 GGGTGGGTGAATTCAAAATGTGG - Intronic
957069982 3:75560086-75560108 GGTTGAGTTAGTGGAAACTGAGG + Intergenic
957597533 3:82287410-82287432 GGGTGAGTGAAGGAAACTTGGGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
962008185 3:131369119-131369141 GGTTGAGTGAATGGAAAATGAGG + Intergenic
965576615 3:170223446-170223468 GGGTGAGATACTGCAAGGTGAGG + Intronic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
976447272 4:85145535-85145557 GTGTGAATTAATGTGAATTGAGG + Intergenic
976953591 4:90866002-90866024 GAGTGAGTTACTGCAAAATCTGG - Intronic
978250320 4:106623145-106623167 AGGTGAATGAAAGCAAATTGTGG - Intergenic
983075305 4:163318197-163318219 GAGTGAGTTATTGCAAAATCTGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986201808 5:5586057-5586079 TGGTGAGTAAATGCAAATTGAGG + Intergenic
986209495 5:5657345-5657367 GGTGGGGTTATTGCAAATTGAGG - Intergenic
988095576 5:26605239-26605261 TGGTGAGTAAATACAAATGGAGG - Intergenic
992580973 5:78175190-78175212 GGGTGAGCTAAAGCAGAGTGGGG - Intronic
994283257 5:97932031-97932053 TGGTGTGTTAATGCAAAAGGAGG - Intergenic
996602998 5:125288668-125288690 GGTGGAATTAATGCAAATAGAGG - Intergenic
997023511 5:130030154-130030176 AGGTGAGATAATTCAAATTGTGG - Intronic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
998947672 5:147358270-147358292 GGGTCAGTTATTGCCAAGTGTGG + Intronic
999044985 5:148457345-148457367 GAGTAAATTAATGCAAATGGGGG - Intronic
1001126816 5:169027075-169027097 GGTTGAGTAAAAGAAAATTGAGG + Intronic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1004302921 6:14474855-14474877 GGGGGAGTTGATGAAAATAGAGG + Intergenic
1006125504 6:31835213-31835235 GGGCGAGTGATTGCAAAATGGGG + Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1008247521 6:49196145-49196167 GTGTGAGTTACTGCAAGTTTGGG - Intergenic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1011715954 6:90105170-90105192 GGGTCAGTGAATGCAACATGGGG - Intronic
1016655860 6:146517685-146517707 TGTTGAGATAATGAAAATTGAGG + Intergenic
1016834175 6:148460536-148460558 TGGAGAGTTAATGATAATTGAGG + Intronic
1019549945 7:1597138-1597160 TGATGAGTTATTGCAAACTGTGG + Intergenic
1023002599 7:35826539-35826561 GGGTGTGTTAAGGTAATTTGAGG + Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1032801812 7:135322841-135322863 GGGTGTGTTAATTCAAATGCAGG - Intergenic
1034663901 7:152798236-152798258 GGGTGAGTTGATTGATATTGTGG + Intronic
1036911963 8:12765209-12765231 GGGTGCGTTTATGCAGTTTGTGG + Intergenic
1037335988 8:17792479-17792501 GGGTCAGTTAATGAAAAGGGAGG - Intronic
1038674036 8:29607263-29607285 GAGAGAATTAATGGAAATTGTGG + Intergenic
1045914525 8:107451146-107451168 GAAAGAGTTAATGCAAATTCTGG - Intronic
1048063698 8:130946846-130946868 GGCTCAGTTAAAGCAGATTGTGG - Intronic
1051011160 9:12416231-12416253 GGGCGAGTCAAAGCAAATTAAGG + Intergenic
1052155587 9:25185243-25185265 GGGTAACTTAATGCAAATCCTGG - Intergenic
1055006964 9:71518600-71518622 GGCTGAATTAATGCAAATATTGG - Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1055774317 9:79751696-79751718 GGGTGCGTTGATGCAAGATGTGG + Intergenic
1056261981 9:84858078-84858100 TGGTGACTGATTGCAAATTGAGG - Intronic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1057928551 9:99173418-99173440 GGGTGACTTATGGCAAATTCTGG + Intergenic
1057928681 9:99174552-99174574 GGGTGACTTTATGGGAATTGGGG + Intergenic
1185951905 X:4446638-4446660 AGGTGAGACAATGCAAAGTGGGG - Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1192819752 X:74632368-74632390 GGGAGAGTGGATGCATATTGTGG - Intergenic
1193210254 X:78799091-78799113 GGGTTAGTCTATGCAAATTTGGG + Intergenic
1193440408 X:81534149-81534171 GACTGAGTTAATGCAAAAAGTGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1199252656 X:145681563-145681585 AGGTGATTTTATGCAAATGGTGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1202110591 Y:21413464-21413486 GGGTCAGTTAATGCTATTTATGG - Intergenic